Kwrigh35 Week 3 - Revision history

Kwrigh35: /* Acknowledgements */ added last 3 bullet points

2017-09-20T05:51:24Z

‎Acknowledgements: added last 3 bullet points

2017-09-20T05:46:47Z

‎The Genetic Code, by Way of the Web: added bullet point 4

2017-09-20T05:44:29Z

‎The Genetic Code, by Way of the Web: added section "using command line to..."

2017-09-20T05:25:37Z

‎Question 1: fixed this question. Found links from curl'd data not actual ExPASy site

2017-09-20T05:17:15Z

‎The Genetic Code, by Way of the Web: added third bullet point

2017-09-20T05:04:28Z

‎Study the Curl'd Code: added a <br>

2017-09-20T05:03:41Z

‎The Genetic Code, by Way of the Web: added response to question 1 of study of curl'd code

2017-09-20T04:17:07Z

‎The Genetic Code, by Way of the Web: took out redundant info

2017-09-20T04:16:15Z

‎The Genetic Code, by Way of the Web: added curl command procedure

2017-09-20T04:14:41Z

‎The Genetic Code, by Way of the Web: added curl command

@@ Line 36: / Line 36: @@
 ==Acknowledgements==
 *I would like to thank my homework partner [[User:Johnllopez616 |John Lopez]] for his help on this assignment.  We worked together Monday afternoon on "The Genetic Code, by Way of the Web" part of the assignment.  We struggled to complete this portion of the assignment, and since it was extended, we decided to ask Professor Dionisio for help after class on Tuesday afternoon. [[User:Kwrigh35|Kwrigh35]] ([[User talk:Kwrigh35|talk]]) 16:27, 19 September 2017 (PDT)
 ==References==

@@ Line 32: / Line 32: @@
 *9/19: To figure out the curl command, I consulted with John's week 3 journal page.  He showed the curl command as a formula, so to confirm that I knew how to use this "formula," I added the appropriate values for pre_text, output, and code. The HTML that Ubuntu gave back to me included the same amino acid sequences/reading frames that I got back from ExPASy when I submitted the DNA sequence with the same parameters.  This indicates that I had found the correct curl command.
 *9/19: To find the links, I went to my web browser and Initially I studied the requests that the ExPASy site made itself.  I just realized that I should be looking at the requests that my curled code made instead, so I am going to go back and amend my answers right now. I plan on opening the .html file that I saved (containing the results I got from my curl'd command) with chrome and using the developer tools to look at the requests made.
 ==Acknowledgements==

@@ Line 20: / Line 20: @@
 I found another link to the Google-Analytics server.  This link was present twice, for a grand total of six requests.
   http://www.google-analytics.com/ga.js <br>
 ==Notebook==

@@ Line 12: / Line 12: @@
 ===Study the Curl'd Code===
 ====Question 1====
-I found 4 links to other pages on the [http://web.expasy.org web.expasy.org] server.
+I found 3 links to other pages on the [http://web.expasy.org web.expasy.org] server. I also found a link to the file I had saved the curl'd html to.  However, since I was viewing an .html file on my computer, the server it tried to access was on the local computer and not the ExPASy server. Therefore, it was represented as a file path and not a webpage.
-  http://web.expasy.org/cgi-bin/translate/dna_aa<br>
+  file:///C:/Users/biolab/Desktop/Week%203%20practice.html ''(the file itself)''<br>
-  http://web.expasy.org/css/sib_images/sib_header_small_bkgd.png<br>
+  file:///C:/css/sib_css/sib.css<br>
-  http://web.expasy.org/css/sib_images/sib_ExPASy_logo_small.png<br>
+  file:///C:/css/base.css<br>
-  http://web.expasy.org/css/sib_images/triangle_hover.png<br>
+  file:///C:/css/sib_css/sib_print.css<br>
-I found 2 unique links to the [http://www.google-analytics.com/ google-analytics.com] server.  Each link was present twice.
+I found another link to the Google-Analytics server.  This link was present twice, for a grand total of six requests.
   http://www.google-analytics.com/ga.js <br>
 ==Notebook==

@@ Line 28: / Line 28: @@
 *My homework partner [[User:Johnllopez616|John]] and I worked on this portion of the assignment together on Monday 9/18 and struggled a lot.  We each worked semi independently, but talked about our ideas and tried different manipulations of the code.
 *9/19: To figure out the curl command, I consulted with John's week 3 journal page.  He showed the curl command as a formula, so to confirm that I knew how to use this "formula," I added the appropriate values for pre_text, output, and code. The HTML that Ubuntu gave back to me included the same amino acid sequences/reading frames that I got back from ExPASy when I submitted the DNA sequence with the same parameters.  This indicates that I had found the correct curl command.
 ==Acknowledgements==

@@ Line 10: / Line 10: @@
   curl -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose ("Metp", spaces between residues) &code=Standard" http://web.expasy.org/cgi-bin/translate/dna_aa <br>
 The result of this command was compared with the HTML from the ExPASy page and the reading frames were confirmed to be the same.
 ==Notebook==

← Older revision		Revision as of 04:14, 20 September 2017
Line 6:		Line 6:

	==The Genetic Code, by Way of the Web==		==The Genetic Code, by Way of the Web==
		+	===Curl Command===
		+	Here is the curl command that requests a translation at the command-line, raw-data level
		+	curl -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose ("Metp", spaces between residues) &code=Standard" http://web.expasy.org/cgi-bin/translate/dna_aa <br>
		+	The result of this command was compared with the HTML from the ExPASy page and the reading frames were confirmed to be the same.

	==Notebook==		==Notebook==