Mbalducc Week 2 - Revision history

Mbalducc: added signature

2017-09-06T02:35:47Z

added signature

2017-09-06T02:02:10Z

added references

2017-09-06T02:00:00Z

added acknowledgements

2017-09-06T01:56:10Z

2017-09-06T01:52:44Z

2017-09-06T01:45:00Z

sixth reading frame

2017-09-06T01:37:26Z

fifth reading frame

2017-09-06T01:31:50Z

fourth reading frame

2017-09-06T01:20:01Z

third reading frame

2017-09-06T01:13:59Z

second reading frame

← Older revision		Revision as of 02:35, 6 September 2017
Line 44:		Line 44:

	While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.		While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
		+
		+	[[User:Mbalducc\|Mbalducc]] ([[User talk:Mbalducc\|talk]]) 19:35, 5 September 2017 (PDT)

	== References ==		== References ==

← Older revision		Revision as of 02:02, 6 September 2017
Line 44:		Line 44:

	While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.		While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
		+
		+	== References ==
		+
		+	LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_1

	== Links ==		== Links ==

← Older revision		Revision as of 02:00, 6 September 2017
Line 38:		Line 38:

	'''Reading frames +1,-2, and -3 are open reading frames.'''		'''Reading frames +1,-2, and -3 are open reading frames.'''
		+
		+	== Acknowledgements ==
		+
		+	I worked with my homework partner, [https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/User:Ebachour Eddie Bachoura] on this assignment.
		+
		+	While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

	== Links ==		== Links ==

@@ Line 1: / Line 1: @@
-== DNA Stand ==
+== DNA Strand ==
 DNA strand:
@@ Line 12: / Line 12: @@
 == Translations ==
-'''Reading frame 1'''
+'''Reading frame +1'''
-  R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L
+'-R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-3'
-'''Reading frame 2'''
+'''Reading frame +2'''
-  c-V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F-ta
+'-c-V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F-ta-3'
-'''Reading frame 3'''
+'''Reading frame +3'''
-  cg-Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F-a
+'-cg-Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F-a-3'
-'''Reading frame 4'''
+'''Reading frame -1'''
-  A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop-N
+'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop-N-5'
-'''Reading frame 5'''
+'''Reading frame -2'''
-  g-H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K-at
+'-g-H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K-at-5'
-'''Reading frame 6'''
+'''Reading frame -3'''
-  gc-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-t
+'-gc-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-t-5'
 == Links ==

@@ Line 1: / Line 1: @@
-== Week 2 ==
+== DNA Stand ==
 DNA strand:
@@ Line 10: / Line 10: @@
 '-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5'
-=== Translations ===
+== Translations ==
 '''Reading frame 1'''

@@ Line 3: / Line 3: @@
 DNA strand:
-'-c gtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcattt ta-3’
+'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
@@ Line 19: / Line 19: @@
   c-V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F-ta
 == Links ==