Mbalducc Week 3 - Revision history

Mbalducc: /* Notebook */

2017-09-19T00:04:49Z

‎Notebook

Mbalducc: /* Studying the curl'ed code */

2017-09-18T23:59:54Z

‎Studying the curl'ed code

Mbalducc: added notebook header

2017-09-18T17:14:57Z

added notebook header

Mbalducc: formatting of responses

2017-09-18T16:39:51Z

formatting of responses

Mbalducc: added response to question #2

2017-09-18T16:38:15Z

added response to question #2

Mbalducc: started answering question #2

2017-09-18T01:38:26Z

started answering question #2

Mbalducc: Added links found in response

2017-09-18T01:29:08Z

Added links found in response

Mbalducc: changed headers

2017-09-18T01:07:54Z

changed headers

Mbalducc: added curl code

2017-09-18T01:02:24Z

added curl code

Mbalducc: added links to my other pages

2017-09-15T16:26:27Z

added links to my other pages

← Older revision		Revision as of 00:04, 19 September 2017
Line 39:		Line 39:

	= Notebook =		= Notebook =
		+
		+	I started this week by working on the hacking a website section. I used LMU's apply page, and opened up the developer tools. I changed the words on screen and added a photo by uploading it to our wiki, and then by linking to it within the tools.
		+
		+	I made the curl code next, by figuring out that the "pre_text" needed to be the sequence of DNA and the action needed to be to submit the "TRANSLATE SEQUENCE" button.
		+
		+	Then, I looked at the developer tools for the response page, and found the links it contained, and the identifiers.
		+
		+	The last thing I did for this individual journal was make a sed code that would show only the answers. This was tricky, as I had trouble figuring out exactly the sequence I needed to get rid of the links within the lines that held what I wanted to be shown.

	= Acknowledgments =		= Acknowledgments =

@@ Line 32: / Line 32: @@
 #*"id=sib_body" This identifies the body of the page, where the results from the translation are located.
 #*"id=sib_footer" This identifies where the footer of the page is.
 = Notebook =

← Older revision		Revision as of 17:14, 18 September 2017
Line 33:		Line 33:
	#*"id=sib_footer" This identifies where the footer of the page is.		#*"id=sib_footer" This identifies where the footer of the page is.

		+	= Notebook =

	= Acknowledgments =		= Acknowledgments =

@@ Line 22: / Line 22: @@
 #There are other links to other pages within the server's response:
-*http://web.expasy.org/favicon.ico. This links to an icon used on the page.
+#*http://web.expasy.org/favicon.ico. This links to an icon used on the page.
-*http://web.expasy.org/css/sib_css/sib.css. This links to a page with the header "Swiss Institute of Bioinformatics".
+#*http://web.expasy.org/css/sib_css/sib.css. This links to a page with the header "Swiss Institute of Bioinformatics".
-*http://web.expasy.org/css/sib_css/sib_print.css. This links to another page from the "Swiss Institute of Bioinformatics".
+#*http://web.expasy.org/css/sib_css/sib_print.css. This links to another page from the "Swiss Institute of Bioinformatics".
-*http://web.expasy.org/css/base.css. This links to a page with the CSS for Genevian Resources.
+#*http://web.expasy.org/css/base.css. This links to a page with the CSS for Genevian Resources.
-*http://en.wikipedia.org/wiki/Open_reading_frame. This links to the Wikipedia page for "Open reading frame".
+#*http://en.wikipedia.org/wiki/Open_reading_frame. This links to the Wikipedia page for "Open reading frame".
 #There are identifiers in the server's response:
-*"id=sib_top" This identifies the top of the page.
+#*"id=sib_top" This identifies the top of the page.
-*"id=sib_container" This identifies the entirety of the space the page is contained within.
+#*"id=sib_container" This identifies the entirety of the space the page is contained within.
-*"id=sib_body" This identifies the body of the page, where the results from the translation are located.
+#*"id=sib_body" This identifies the body of the page, where the results from the translation are located.
-*"id=sib_footer" This identifies where the footer of the page is.
+#*"id=sib_footer" This identifies where the footer of the page is.

@@ Line 28: / Line 28: @@
 *http://en.wikipedia.org/wiki/Open_reading_frame. This links to the Wikipedia page for "Open reading frame".
 #There are identifiers in the server's response:
+*"id=sib_top" This identifies the top of the page.
 = Acknowledgments =

← Older revision		Revision as of 01:29, 18 September 2017
Line 18:		Line 18:

	curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa		curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
		+
		+	=== Studying the curl'ed code ===
		+
		+	#There are other links to other pages within the server's response:
		+	*http://web.expasy.org/favicon.ico. This links to an icon used on the page.
		+	*http://web.expasy.org/css/sib_css/sib.css. This links to a page with the header "Swiss Institute of Bioinformatics".
		+	*http://web.expasy.org/css/sib_css/sib_print.css. This links to another page from the "Swiss Institute of Bioinformatics".
		+	*http://web.expasy.org/css/base.css. This links to a page with the CSS for Genevian Resources.
		+	*http://en.wikipedia.org/wiki/Open_reading_frame. This links to the Wikipedia page for "Open reading frame".

	= Acknowledgments =		= Acknowledgments =

@@ Line 25: / Line 25: @@
 While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
-== References ==
+= References =
 LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from

@@ Line 1: / Line 1: @@
-= Hack-a-Page=
+= Hack-a-Page =
 == Screenshots ==
@@ Line 13: / Line 13: @@
 [[file:mbalducc modified page w-o tools open.jpg|1000px]]
-== Acknowledgments ==
+= Curl Code =
 I worked with my homework partner, [[user:bhamilton18|Blair Hamilton]] on this assignment. We met after class to work on the "hack-a-page" section of the assignment together.

← Older revision		Revision as of 16:26, 15 September 2017
Line 25:		Line 25:

	Palmo, Candace. n.d. ''Lion's Roar 2'' [photograph]. Retrieved September 14, 2017, from https://candacepalmo.files.wordpress.com/2014/03/lions-roar-2.jpg		Palmo, Candace. n.d. ''Lion's Roar 2'' [photograph]. Retrieved September 14, 2017, from https://candacepalmo.files.wordpress.com/2014/03/lions-roar-2.jpg
		+
		+	{{Template:mbalducc}}

	[[Category: Journal Entry]]		[[Category: Journal Entry]]