Simonwro120 Week 3 - Revision history

Simonwro120: added references

2017-09-20T20:11:48Z

added references

Simonwro120: Moved notes to Electronic lab section and moved template

2017-09-19T23:15:18Z

Moved notes to Electronic lab section and moved template

Simonwro120: commented out

2017-09-18T19:04:35Z

commented out

Simonwro120: added comment for now, and syntax change

2017-09-18T18:31:36Z

added comment for now, and syntax change

Simonwro120: syntax fix

2017-09-18T10:37:42Z

syntax fix

Simonwro120: syntax fix

2017-09-18T10:35:21Z

syntax fix

Simonwro120: added another Acknowledgement

2017-09-18T10:34:26Z

added another Acknowledgement

Simonwro120: Syntax and set up

2017-09-18T10:23:54Z

Syntax and set up

Simonwro120: Added Acknowledgement

2017-09-18T09:52:45Z

Added Acknowledgement

Simonwro120: syntax fix

2017-09-18T09:36:21Z

syntax fix

@@ Line 44: / Line 44: @@
 *I used the website http://www.beardeddragonguide.com as the website I modified and took screen shots of.
 ==References==
-*LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3
+*13 Awesome Linux Grep Command Examples. (2017). Retrieved September 16, 2017, from https://tecadmin.net/grep-command-in-linux/
 [[Category:Journal Entry]]
 [[User:Simonwro120|Simonwro120]] ([[User talk:Simonwro120|talk]]) 03:35, 18 September 2017 (PDT)

@@ Line 5: / Line 5: @@
 ===Without DevTools===
   [[Image:After-bioPic.png|500px]]
 ==The Genetic Code, by Way of the Web==
 ===curl Command===
   curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
 ==ExPASy Questions==
 ===Question 1===
@@ Line 33: / Line 23: @@
 *"POST" identifier tells the browser how to contact the server.
 ==Just the Answers Using the Command Line==
-<!-- curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g' <!--Got this from Eddie--> -->
+ curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g' <!--Recieved help from Eddie Azinge-->
 ==Acknowledgements==
 *Thanks to Doctors Dahquist and Dondi to helping clarify the assignments instructions.
@@ Line 41: / Line 43: @@
 *Although all those listed above contributed to my completing this work, all of its contents came from me alone.
 *I used the website http://www.beardeddragonguide.com as the website I modified and took screen shots of.
 ==References==
 *LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3
 [[Category:Journal Entry]]
 [[User:Simonwro120|Simonwro120]] ([[User talk:Simonwro120|talk]]) 03:35, 18 September 2017 (PDT)

@@ Line 33: / Line 33: @@
 *"POST" identifier tells the browser how to contact the server.
 ==Just the Answers Using the Command Line==
- curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g' <!--Got this from Eddie-->
+<!-- curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g' <!--Got this from Eddie--> -->
 ==Acknowledgements==
 *Thanks to Doctors Dahquist and Dondi to helping clarify the assignments instructions.

@@ Line 33: / Line 33: @@
 *"POST" identifier tells the browser how to contact the server.
 ==Just the Answers Using the Command Line==
-  curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g'
+  curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g' <!--Got this from Eddie-->
 ==Acknowledgements==
 *Thanks to Doctors Dahquist and Dondi to helping clarify the assignments instructions.
 *Thanks to "subfuzion' an account name for someone who helped me on gitHub.
-*Special thanks to [[UserCazinge|Eddie Azinge]] and [[User:Bhamilton18|Blair Hamilton]]. With their help, I was able to learn what the "sed" command in curl was capable of.
+*Special thanks to [[User:Cazinge|Eddie Azinge]] and [[User:Bhamilton18|Blair Hamilton]]. With their help, I was able to learn what the "sed" command in curl was capable of.
 *Worked with partner to go over questions and complete assignment.
 *Although all those listed above contributed to my completing this work, all of its contents came from me alone.

@@ Line 40: / Line 40: @@
 *Worked with partner to go over questions and complete assignment.
 *Although all those listed above contributed to my completing this work, all of its contents came from me alone.
-*I used the website [http://www.beardeddragonguide.com/] as the website I modified and took screen shots of.
+*I used the website http://www.beardeddragonguide.com as the website I modified and took screen shots of.
 ==References==
 *LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3

@@ Line 1: / Line 1: @@
 =Electronic Laboratory Notebook=
 ==Hack-a-Page==
 *First I accessed a website of my choosing and right clicked in Google Chrome to induce the dropdown menu.
 *I then clicked on "Inspect" to bring up the developer tools.
 *I then found a paragraph located next to a linked image and chose that part of the website as my target for modification.
 *After that, all I had to do was find the right code, modify it in any way I saw fit, and take my screenshots.
 ==The Genetic Code, by Way of the Web==
 *First I looked over a few basic curl commands to get a feel for how it works.
 *I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script.
 *After some research, I started to fiddle wit the command line.
 *To verify that my command was correct, I searched the the code that was returned by the terminal representing the amino acid chains and cross referenced them with the already known correct sequences.
-===cURL command===
+==ExPASy Questions==
- curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
+===Question 1===
-===ExPASy Questions===
+'''The server's response does have some links to other pages which include:'''
 *[http://web.expasy.org/css/sib_css/sib.css This] is a link to a page full of text resembling code and titled ''Swiss Institute of Bioinformatics''.
 *[http://web.expasy.org/favicon.ico This] is a link to an their logo.
@@ Line 23: / Line 26: @@
 *[http://en.wikipedia.org/wiki/Open_reading_frame This] is a link to a wikipedia page explaining Open reading frames as they pertain to biology.
 *[http://web.expasy.org/css/base.css This] link is similar to 1 and 3. Another text file, however this one is titles ''CSS for Genevian Resources''.
-===Just the Answers Using the Command Line===
+===Question 2===
 ==Acknowledgements==
-*Special Thanks to Doctors Dahquist and Dondi to helping clarify the assignments instructions.
+*Thanks to Doctors Dahquist and Dondi to helping clarify the assignments instructions.
 *Thanks to "subfuzion' an account name for someone who helped me on gitHub.
-*Thanks to [[User:Bhamilton18|Blair Hamilton]]. With her help, I was able to learn what the "sed" command in curl.
+*Special thanks to [[UserCazinge|Eddie Azinge]] and [[User:Bhamilton18|Blair Hamilton]]. With their help, I was able to learn what the "sed" command in curl was capable of.
 *Worked with partner to go over questions and complete assignment.
 *Although all those listed above contributed to my completing this work, all of its contents came from me alone.
@@ Line 33: / Line 42: @@
 ==References==
 #LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3
 {{simonwro120}}
 [[Category:Journal Entry]]

@@ Line 17: / Line 17: @@
   curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
 ===ExPASy Questions===
-'''The server's response does have links to other pages including:'''
+#'''The server's response does have links to other pages including:'''
- #[http://web.expasy.org/css/sib_css/sib.css This] is a link to a page full of text resembling code and titled "Swiss Institute of Bioinformatics".
+*[http://web.expasy.org/css/sib_css/sib.css This] is a link to a page full of text resembling code and titled ''Swiss Institute of Bioinformatics''.
- #[http://web.expasy.org/favicon.ico This] is a link to an their logo.
+*[http://web.expasy.org/favicon.ico This] is a link to an their logo.
- #[http://web.expasy.org/css/sib_css/sib_print.css This] link is very similar to my first. Just another text page titled "Swiss Institute of Bioinformatics".
+*[http://web.expasy.org/css/sib_css/sib_print.css This] link is very similar to my first. Just another text page titled ''Swiss Institute of Bioinformatics''.
- #[http://en.wikipedia.org/wiki/Open_reading_frame This] is a link to a wikipedia page explaining Open reading frames as they pertain to biology.
+*[http://en.wikipedia.org/wiki/Open_reading_frame This] is a link to a wikipedia page explaining Open reading frames as they pertain to biology.
- #[http://web.expasy.org/css/base.css This] link is similar to 1 and 3. Another text file, however this one is titles ''CSS for Genevian Resources''
+*[http://web.expasy.org/css/base.css This] link is similar to 1 and 3. Another text file, however this one is titles ''CSS for Genevian Resources''.
 ===Using the Command Line to Extract Just the Answers===
 ==Acknowledgements==