Difference between revisions of "Kwrigh35 Week 3"

Revision as of 05:04, 20 September 2017

Hack a Page

Screenshot with Developer Tools Open

Screenshot without Developer Tools Open

The Genetic Code, by Way of the Web

Curl Command

Here is the curl command that requests a translation at the command-line, raw-data level

curl -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose ("Metp", spaces between residues) &code=Standard" http://web.expasy.org/cgi-bin/translate/dna_aa 

The result of this command was compared with the HTML from the ExPASy page and the reading frames were confirmed to be the same.

Study the Curl'd Code

Question 1

I found 4 links to other pages on the web.expasy.org server.

http://web.expasy.org/cgi-bin/translate/dna_aa

http://web.expasy.org/css/sib_images/sib_header_small_bkgd.png

http://web.expasy.org/css/sib_images/sib_ExPASy_logo_small.png

http://web.expasy.org/css/sib_images/triangle_hover.png

I found 2 unique links to the google-analytics.com server. Each link was present twice.

http://www.google-analytics.com/ga.js 

A page on the google-analytics server with a very long URL 

Notebook

Hack-a-Page

For this portion of the assignment, I decided that I wanted LMU to hire some famous new faculty members. Most of the new faculty members are famous scientists who have made major contributions to the field of Biology. I also wanted LMU to hire a New Caledonian Crow, because Professor Auger insists that they are one of the most intelligent animal species on Earth. I found the images by doing a simple google search for each of them. To replace them, I opened developer tools, used the element selector tool (Ctrl+Shift+C) to click on the image I wanted to select, and then pasted the image url directly into the html. I also used the selector tool to find the html for the professor's names and emails and replaced those.

The Genetic Code, by Way of the Web

• My homework partner John and I worked on this portion of the assignment together on Monday 9/18 and struggled a lot. We each worked semi independently, but talked about our ideas and tried different manipulations of the code.
• 9/19: To figure out the curl command, I consulted with John's week 3 journal page. He showed the curl command as a formula, so to confirm that I knew how to use this "formula," I added the appropriate values for pre_text, output, and code. The HTML that Ubuntu gave back to me included the same amino acid sequences/reading frames that I got back from ExPASy when I submitted the DNA sequence with the same parameters. This indicates that I had found the correct curl command.

Acknowledgements

• I would like to thank my homework partner John Lopez for his help on this assignment. We worked together Monday afternoon on "The Genetic Code, by Way of the Web" part of the assignment. We struggled to complete this portion of the assignment, and since it was extended, we decided to ask Professor Dionisio for help after class on Tuesday afternoon. Kwrigh35 (talk) 16:27, 19 September 2017 (PDT)

References

LMU BioDB 2017. (2017). Week 3. Retrieved September 18, 2017, from Week 3
LMU BioDB 2017. (2017). Dynamic Text Processing. Retrieved September 18, 2017, from Dynamic Text Processing
LMU BioDB 2017. (2017). Introduction to the Command Line. Retrieved September 18, 2017, from Introduction to the Command Line

Useful Links