Difference between revisions of "Aporras1 Week 3"

From LMU BioDB 2017
Jump to: navigation, search
(References: added 4th reference)
(Study the curl'ed Code: added identifiers from notebook)
 
(2 intermediate revisions by the same user not shown)
Line 19: Line 19:
  
 
  curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
 
  curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
 +
 +
==Study the curl'ed Code==
 +
'''Question 1:'''
 +
#http://www.w3.org/TR/html4/loose.dtd : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures."
 +
#http://web.expasy.org/favicon.ico : The logo for Expasy.
 +
#http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics.
 +
#https://www.expasy.org : The Expasy Bioinformatics Resource Portal.
 +
#http://web.expasy.org/translate/ : Expasy translation tool.
 +
#https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.
 +
#https://www.expasy.org/disclaimer.html : Expasy disclaimer.
 +
 +
'''Question 2'''
 +
#sib_top: The top of the webpage.
 +
#sib_container: The "container" of the webpage.
 +
#sib_header_small: The small header for the webpage.
 +
#sib_body: The "body" of the webpage outside of the container.
 +
#sib_footer: The footer at the bottom of the webpage.
 +
#sib_expasy_logo: Logo at the top right of the page.
 +
#resource_header: Header of the webpage.
 +
#sib_header_nav: Homepage link at the top right of the page for navigation.
  
 
==Acknowledgements==
 
==Acknowledgements==
Line 32: Line 52:
 
#Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].
 
#Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].
 
#xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].
 
#xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].
 +
#LMU BioDB 2017. (2017). Week 3. Retrieved September 16, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3

Latest revision as of 06:37, 20 September 2017

User Page: Antonio Porras

Assignment Page: Week 3

Electronic Notebook Link

Electronic Notebook

"Hacked" Page with Developer Tools Visible

File:900pixels

"Hacked" Page without Developer Tools Visible

File:900pixels

DMing the Server with curl

Final curl code:

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

Study the curl'ed Code

Question 1:

  1. http://www.w3.org/TR/html4/loose.dtd : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures."
  2. http://web.expasy.org/favicon.ico : The logo for Expasy.
  3. http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics.
  4. https://www.expasy.org : The Expasy Bioinformatics Resource Portal.
  5. http://web.expasy.org/translate/ : Expasy translation tool.
  6. https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.
  7. https://www.expasy.org/disclaimer.html : Expasy disclaimer.

Question 2

  1. sib_top: The top of the webpage.
  2. sib_container: The "container" of the webpage.
  3. sib_header_small: The small header for the webpage.
  4. sib_body: The "body" of the webpage outside of the container.
  5. sib_footer: The footer at the bottom of the webpage.
  6. sib_expasy_logo: Logo at the top right of the page.
  7. resource_header: Header of the webpage.
  8. sib_header_nav: Homepage link at the top right of the page for navigation.

Acknowledgements

  1. Met outside of class with Simon Wroblewski to discuss any questions we had prior to meeting and throughout the process of completing the Week 3 assignment.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

Aporras1 (talk) 16:18, 17 September 2017 (PDT)

References

  1. Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size
  2. Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm
  3. Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].
  4. xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].
  5. LMU BioDB 2017. (2017). Week 3. Retrieved September 16, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3