Difference between revisions of "Zvanysse Week 2"

From LMU BioDB 2017
Jump to: navigation, search
Line 4: Line 4:
 
  5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’
 
  5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’
 
#+1 5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN
 
#+1 5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN
−
#+2 5’ – V-C – 3’
+
#+2 5’ – V-C-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F – 3’
−
#+3 5’ – Y-A-N-T-M-F-R-V – 3’
+
#+3 5’ – Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F – 3’
  
 
'''Complementary Strands'''
 
'''Complementary Strands'''

Revision as of 15:17, 11 September 2017

Week 2 Assignment Page

Translating T's to U's

5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’
  1. +1 5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN
  2. +2 5’ – V-C-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F – 3’
  3. +3 5’ – Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F – 3’

Complementary Strands 

3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’

Careful! Reading backwards

  1. -1 --- Started with stop codon
  2. -2 5’ – K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 3’ OPEN
  3. -3 5’ – K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 3’ OPEN

Acknowledgments

  • Worked with Corinne Wong on understanding how to read the DNA strands
  • Used Wikipedia amino acids chart

References

Retrieved from "https://xmlpipedb.lmucs.io/biodb/fall2017/index.php?title=Zvanysse_Week_2&oldid=837"