Difference between revisions of "Emmatyrnauer Week 2"

From LMU BioDB 2017
Jump to: navigation, search
(fixing syntax)
m (syntax)
Line 6: Line 6:
 
  3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
 
  3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
 
=====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)=====
 
=====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)=====
*stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T
+
*5'- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T -3'
*K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame)
+
*5'- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I -3' (open reading frame)
*K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame)
+
*5'- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y -3' (open reading frame)
  
 
===Complementary strand===
 
===Complementary strand===
Line 15: Line 15:
 
  5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
 
  5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
 
=====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)=====
 
=====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)=====
  *R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame)
+
  *5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3' (open reading frame)
  *V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F  
+
  *5'- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F -3'
  *Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F
+
  *3'- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F -3'
  
 
==Acknowledgments==
 
==Acknowledgments==

Revision as of 02:19, 12 September 2017

Week 2 Individual Assignment

Strand Provided

5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’

mRNA synthesized from this strand

3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)
*5'- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T -3'
*5'- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I -3' (open reading frame)
*5'- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y -3' (open reading frame)

Complementary strand

3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’

mRNA synthesized from this strand

5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)
*5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3' (open reading frame)
*5'- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F -3' 
*3'- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F -3'

Acknowledgments

  1. I worked with my homework partner John Lopez in class. We met face-to-face one time outside of class.
  2. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

Emmatyrnauer (talk) 23:09, 10 September 2017 (PDT)

References

LMU BioDB 2017. (2017). Week 2. Retrieved September 10, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2