Difference between revisions of "Ebachour Week 2"

From LMU BioDB 2017
Jump to: navigation, search
(Added template)
(Added references)
 
(One intermediate revision by the same user not shown)
Line 19: Line 19:
 
===-3===
 
===-3===
 
  3’- I R L W Y K A H I G S A V K A T A V K -5’
 
  3’- I R L W Y K A H I G S A V K A T A V K -5’
==Acknowledgements==
+
=Acknowledgements=
 
[[User:Mbalducc |Mary Balducci]] & I didn't have time to meet in person, but I texted her with my questions about reading frames.
 
[[User:Mbalducc |Mary Balducci]] & I didn't have time to meet in person, but I texted her with my questions about reading frames.
  
 
'''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.'''
 
'''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.'''
 +
[[User:Ebachour|Ebachour]] ([[User talk:Ebachour|talk]]) 15:43, 12 September 2017 (PDT)
  
 
[[User:Ebachour|Ebachour]] ([[User talk:Ebachour|talk]]) 23:24, 11 September 2017 (PDT)
 
[[User:Ebachour|Ebachour]] ([[User talk:Ebachour|talk]]) 23:24, 11 September 2017 (PDT)
 +
=References=
 +
LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
  
 
{{Template: Ebachour}}
 
{{Template: Ebachour}}

Latest revision as of 22:43, 12 September 2017

Edward Bachoura: Journal Week 2

Finding the Complimentary Strand

Original Strand

5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’

Complimentary Strand

3’- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5’

Translated Reading Frames

5’- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ - Bottom Strand of RNA

+3

5’- Y A N T M F R V STOP P S R Q F R W R H F -3’

+2

5’- V C STOP Y H V O R I T Q P P V P L A A F -3’

+1

5’- R M L I P C S A Y N P A A S S A G G I L -3’

-1

3’- A Y D Y G T R R I L G R R S R R P P STOP N -5’

-2

3’- H T I M V Q G A Y W V G G Q G D R R K -5’

-3

3’- I R L W Y K A H I G S A V K A T A V K -5’

Acknowledgements

Mary Balducci & I didn't have time to meet in person, but I texted her with my questions about reading frames.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source. Ebachour (talk) 15:43, 12 September 2017 (PDT)

Ebachour (talk) 23:24, 11 September 2017 (PDT)

References

LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2

Navigate to the Rest of my Pages

Eddie Bachoura

Biological Databases Homepage

Assignment Pages

Journal Entries

Shared Journal Entries