Difference between revisions of "Aporras1 Week 3"
From LMU BioDB 2017
(added acknowledgements and references) |
(→Study the curl'ed Code: added identifiers from notebook) |
||
(14 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
User Page: [[User:Aporras1|Antonio Porras]] | User Page: [[User:Aporras1|Antonio Porras]] | ||
+ | |||
Assignment Page: [[Week 3|Week 3]] | Assignment Page: [[Week 3|Week 3]] | ||
==Electronic Notebook Link== | ==Electronic Notebook Link== | ||
[[Aporras1 Electronic Notebook|Electronic Notebook]] | [[Aporras1 Electronic Notebook|Electronic Notebook]] | ||
+ | |||
+ | =="Hacked" Page with Developer Tools Visible== | ||
+ | |||
+ | [[File:Aporras1' Hacked Page with Developer Tools.png|900px|File:900pixels]] | ||
+ | |||
+ | =="Hacked" Page without Developer Tools Visible== | ||
+ | |||
+ | [[File:Aporras1's Hacked Page without Developer Tools.png|900px|File:900pixels]] | ||
+ | |||
+ | ==DMing the Server with curl== | ||
+ | |||
+ | '''Final curl code:''' | ||
+ | |||
+ | curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | ||
+ | |||
+ | ==Study the curl'ed Code== | ||
+ | '''Question 1:''' | ||
+ | #http://www.w3.org/TR/html4/loose.dtd : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures." | ||
+ | #http://web.expasy.org/favicon.ico : The logo for Expasy. | ||
+ | #http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics. | ||
+ | #https://www.expasy.org : The Expasy Bioinformatics Resource Portal. | ||
+ | #http://web.expasy.org/translate/ : Expasy translation tool. | ||
+ | #https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as. | ||
+ | #https://www.expasy.org/disclaimer.html : Expasy disclaimer. | ||
+ | |||
+ | '''Question 2''' | ||
+ | #sib_top: The top of the webpage. | ||
+ | #sib_container: The "container" of the webpage. | ||
+ | #sib_header_small: The small header for the webpage. | ||
+ | #sib_body: The "body" of the webpage outside of the container. | ||
+ | #sib_footer: The footer at the bottom of the webpage. | ||
+ | #sib_expasy_logo: Logo at the top right of the page. | ||
+ | #resource_header: Header of the webpage. | ||
+ | #sib_header_nav: Homepage link at the top right of the page for navigation. | ||
==Acknowledgements== | ==Acknowledgements== | ||
#Met outside of class with [[User:Simonwro120|Simon Wroblewski]] to discuss any questions we had prior to meeting and throughout the process of completing the Week 3 assignment. | #Met outside of class with [[User:Simonwro120|Simon Wroblewski]] to discuss any questions we had prior to meeting and throughout the process of completing the Week 3 assignment. | ||
+ | |||
'''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.''' | '''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.''' | ||
+ | |||
[[User:Aporras1|Aporras1]] ([[User talk:Aporras1|talk]]) 16:18, 17 September 2017 (PDT) | [[User:Aporras1|Aporras1]] ([[User talk:Aporras1|talk]]) 16:18, 17 September 2017 (PDT) | ||
==References== | ==References== | ||
+ | #Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size | ||
+ | #Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm | ||
+ | #Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017]. | ||
+ | #xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017]. | ||
+ | #LMU BioDB 2017. (2017). Week 3. Retrieved September 16, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3 |
Latest revision as of 06:37, 20 September 2017
User Page: Antonio Porras
Assignment Page: Week 3
Contents
Electronic Notebook Link
"Hacked" Page with Developer Tools Visible
"Hacked" Page without Developer Tools Visible
DMing the Server with curl
Final curl code:
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
Study the curl'ed Code
Question 1:
- http://www.w3.org/TR/html4/loose.dtd : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures."
- http://web.expasy.org/favicon.ico : The logo for Expasy.
- http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics.
- https://www.expasy.org : The Expasy Bioinformatics Resource Portal.
- http://web.expasy.org/translate/ : Expasy translation tool.
- https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.
- https://www.expasy.org/disclaimer.html : Expasy disclaimer.
Question 2
- sib_top: The top of the webpage.
- sib_container: The "container" of the webpage.
- sib_header_small: The small header for the webpage.
- sib_body: The "body" of the webpage outside of the container.
- sib_footer: The footer at the bottom of the webpage.
- sib_expasy_logo: Logo at the top right of the page.
- resource_header: Header of the webpage.
- sib_header_nav: Homepage link at the top right of the page for navigation.
Acknowledgements
- Met outside of class with Simon Wroblewski to discuss any questions we had prior to meeting and throughout the process of completing the Week 3 assignment.
While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Aporras1 (talk) 16:18, 17 September 2017 (PDT)
References
- Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size
- Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm
- Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].
- xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].
- LMU BioDB 2017. (2017). Week 3. Retrieved September 16, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3