Difference between revisions of "Zvanysse Week 2"
From LMU BioDB 2017
(2 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
[[Week_2| Week 2 Assignment Page]] | [[Week_2| Week 2 Assignment Page]] | ||
− | + | ==Original Strand== | |
− | + | 5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta - 3’ | |
==Translating T's to U's== | ==Translating T's to U's== | ||
5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’ | 5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’ | ||
− | + | ==Translating to Amino Acids== | |
− | + | ===+1=== | |
− | + | 5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN | |
+ | ===+2=== | ||
+ | 5’ – V-C-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F – 3’ | ||
+ | ===+3=== | ||
+ | 5’ – Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F – 3’ | ||
'''Complementary Strands''' | '''Complementary Strands''' | ||
Line 12: | Line 16: | ||
3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’ | 3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’ | ||
'''Careful! Reading backwards''' | '''Careful! Reading backwards''' | ||
− | + | ===-1=== | |
− | + | 5' -Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3' | |
− | + | ===-2=== | |
+ | 5’ – K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 3’ OPEN | ||
+ | ===-3=== | ||
+ | 5’ – K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 3’ OPEN | ||
==Acknowledgments== | ==Acknowledgments== | ||
*Worked with Corinne Wong on understanding how to read the DNA strands | *Worked with Corinne Wong on understanding how to read the DNA strands | ||
− | * | + | *Emailed Dahlquist for clarification on the assignment |
+ | [[User:Zvanysse|Zvanysse]] ([[User talk:Zvanysse|talk]]) 09:38, 11 September 2017 (PDT) | ||
==References== | ==References== | ||
*LMU BioDB 2017. (2017). Week 2. Retrieved September 9, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2 | *LMU BioDB 2017. (2017). Week 2. Retrieved September 9, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2 | ||
+ | *[http://2.bp.blogspot.com/-SW0Fnc0Bsb8/URutxvDAaEI/AAAAAAAAAVM/0rsFvgUug1k/s1600/url.jpg| Amino Acid Chart] |
Latest revision as of 16:39, 11 September 2017
Contents
Original Strand
5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta - 3’
Translating T's to U's
5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’
Translating to Amino Acids
+1
5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN
+2
5’ – V-C-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F – 3’
+3
5’ – Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F – 3’
Complementary Strands
3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’
Careful! Reading backwards
-1
5' -Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3'
-2
5’ – K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 3’ OPEN
-3
5’ – K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 3’ OPEN
Acknowledgments
- Worked with Corinne Wong on understanding how to read the DNA strands
- Emailed Dahlquist for clarification on the assignment
Zvanysse (talk) 09:38, 11 September 2017 (PDT)
References
- LMU BioDB 2017. (2017). Week 2. Retrieved September 9, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
- Amino Acid Chart