Difference between revisions of "Emmatyrnauer Week 2"

From LMU BioDB 2017
Jump to: navigation, search
(labeling open reading frame)
(adding category journal entry)
 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
==Strand Provided==
 
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’
 
===mRNA synthesized from this strand===
 
3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
 
====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)====
 
*stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T
 
*K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame)
 
*K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame)
 
  
==Complementary strand==
+
==Week 2 Individual Assignment==
3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’
+
===Strand Provided===
===mRNA synthesized from this strand===
+
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’
5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
+
====mRNA synthesized from this strand====
====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)====
+
3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
*R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame)
+
=====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)=====
*V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F  
+
*N Ter- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T -C Ter
*Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F
+
*N Ter- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I -C Ter (open reading frame)
 +
*N Ter- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y -C Ter (open reading frame)
 +
 
 +
===Complementary strand===
 +
3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’
 +
====mRNA synthesized from this strand====
 +
5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
 +
=====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)=====
 +
*N Ter- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -C Ter (open reading frame)
 +
*N Ter- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F -C Ter
 +
*N Ter- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F -C Ter
 +
 
 +
==Acknowledgments==
 +
#I worked with my homework partner [[User:Johnllopez616|John Lopez]] in class. We met face-to-face one time outside of class.
 +
#While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
 +
[[User:Emmatyrnauer|Emmatyrnauer]] ([[User talk:Emmatyrnauer|talk]]) 23:09, 10 September 2017 (PDT)
 +
==References==
 +
LMU BioDB 2017. (2017). Week 2. Retrieved September 10, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
 +
 
 +
[[Category:Journal Entry]]

Latest revision as of 04:32, 20 September 2017

Week 2 Individual Assignment

Strand Provided

5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’

mRNA synthesized from this strand

3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)
*N Ter- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T -C Ter
*N Ter- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I -C Ter (open reading frame)
*N Ter- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y -C Ter (open reading frame)

Complementary strand

3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’

mRNA synthesized from this strand

5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)
*N Ter- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -C Ter (open reading frame)
*N Ter- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F -C Ter 
*N Ter- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F -C Ter

Acknowledgments

  1. I worked with my homework partner John Lopez in class. We met face-to-face one time outside of class.
  2. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

Emmatyrnauer (talk) 23:09, 10 September 2017 (PDT)

References

LMU BioDB 2017. (2017). Week 2. Retrieved September 10, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2