Difference between revisions of "Cwong34 Week 2"
From LMU BioDB 2017
(Added dna exercise) |
(Added acknowledgment and signature) |
||
(4 intermediate revisions by the same user not shown) | |||
Line 11: | Line 11: | ||
+1: 5’- RMLIPCSAYNPAASSAGGIL – 3’ '''OPEN reading frame''' | +1: 5’- RMLIPCSAYNPAASSAGGIL – 3’ '''OPEN reading frame''' | ||
− | +2: 5’ – VC “STOP” YHVPRITQPPVPLAAF – 3’ | + | +2: 5’ – VC ''“STOP”'' YHVPRITQPPVPLAAF – 3’ |
− | +3: 5’ – YANTMFRV “STOP” PSRQFRWRHF – 3’ | + | +3: 5’ – YANTMFRV ''“STOP”'' PSRQFRWRHF – 3’ |
− | -1: 5’ – “STOP” NAASGTGGWVIRGTWY “STOP” HT – 3’ | + | -1: 5’ – ''“STOP”'' NAASGTGGWVIRGTWY “STOP” HT – 3’ |
-2: 5’ – KMPPAELAAGLYAEHGISI – 3’ '''OPEN reading frame''' | -2: 5’ – KMPPAELAAGLYAEHGISI – 3’ '''OPEN reading frame''' | ||
Line 23: | Line 23: | ||
==Acknowledgments== | ==Acknowledgments== | ||
# I worked with Zach Van Ysseldyk on translating the DNA and getting the six different reading frames. | # I worked with Zach Van Ysseldyk on translating the DNA and getting the six different reading frames. | ||
+ | #Dr. Dahlquist clarified some questions about how she wanted the strands to be translated. | ||
+ | #While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source. | ||
+ | |||
+ | [[User:Cwong34|Cwong34]] ([[User talk:Cwong34|talk]]) 15:27, 25 September 2017 (PDT) | ||
==References== | ==References== | ||
+ | #Halwah, I. (2017). ''AMINO ACID CHART.url.jpg'' [Image]. Retrieved September 9, 2017, from http://www.sopformatsample.com/wp-content/uploads/2017/02/amino-acid-chart-url.jpg | ||
#LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2 | #LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2 | ||
+ | |||
+ | {{Template:cwong34}} | ||
+ | |||
+ | [[Category:Journal Entry]] |
Latest revision as of 22:27, 25 September 2017
DNA Decoding
5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta - 3’
Transcription
5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’
Translation
+1: 5’- RMLIPCSAYNPAASSAGGIL – 3’ OPEN reading frame
+2: 5’ – VC “STOP” YHVPRITQPPVPLAAF – 3’
+3: 5’ – YANTMFRV “STOP” PSRQFRWRHF – 3’
-1: 5’ – “STOP” NAASGTGGWVIRGTWY “STOP” HT – 3’
-2: 5’ – KMPPAELAAGLYAEHGISI – 3’ OPEN reading frame
-3: 5’ – KCRQRNWRLGYTRNMVLAY – 3’ OPEN reading frame
Acknowledgments
- I worked with Zach Van Ysseldyk on translating the DNA and getting the six different reading frames.
- Dr. Dahlquist clarified some questions about how she wanted the strands to be translated.
- While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Cwong34 (talk) 15:27, 25 September 2017 (PDT)
References
- Halwah, I. (2017). AMINO ACID CHART.url.jpg [Image]. Retrieved September 9, 2017, from http://www.sopformatsample.com/wp-content/uploads/2017/02/amino-acid-chart-url.jpg
- LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
BIOL/CMSI 367-01: Biological Databases Fall 2017
Assignments
- Week 1
- Week 2
- Week 3
- Week 4
- Week 5
- Week 6
- Week 7
- Week 8
- Week 9
- Week 10
- Week 11
- Week 12
- Week 14
- Week 15
Journal Entries:
- cwong34 Week 2
- cwong34 Week 3
- cwong34 Week 4
- cwong34 Week 5
- cwong34 Week 6
- cwong34 Week 7
- cwong34 Week 8
- cwong34 Week 9
- cwong34 Week 10
- cwong34 Week 11
- cwong34 Week 12
- cwong34 Week 14
- cwong34 Week 15
Shared Journals:
- cwong34 Week 1 Journal
- cwong34 Week 2 Journal
- cwong34 Week 3 Journal
- cwong34 Week 4 Journal
- cwong34 Week 5 Journal
- cwong34 Week 6 Journal
- cwong34 Week 7 Journal
- cwong34 Week 8 Journal
- cwong34 Week 9 Journal
- cwong34 Week 10 Journal
Group Project