Difference between revisions of "Simonwro120 Week 3"
From LMU BioDB 2017
Simonwro120 (talk | contribs) (Added Acknowledgement) |
Simonwro120 (talk | contribs) (Syntax and set up) |
||
| Line 1: | Line 1: | ||
=Electronic Laboratory Notebook= | =Electronic Laboratory Notebook= | ||
==Hack-a-Page== | ==Hack-a-Page== | ||
| + | ===With DevTools=== | ||
| + | [[Image:Before-pic-biodb.png|1000px]] | ||
| + | ===Without DevTools=== | ||
| + | [[Image:After-bioPic.png|500px]] | ||
| + | '''Notes:''' | ||
*First I accessed a website of my choosing and right clicked in Google Chrome to induce the dropdown menu. | *First I accessed a website of my choosing and right clicked in Google Chrome to induce the dropdown menu. | ||
*I then clicked on "Inspect" to bring up the developer tools. | *I then clicked on "Inspect" to bring up the developer tools. | ||
*I then found a paragraph located next to a linked image and chose that part of the website as my target for modification. | *I then found a paragraph located next to a linked image and chose that part of the website as my target for modification. | ||
*After that, all I had to do was find the right code, modify it in any way I saw fit, and take my screenshots. | *After that, all I had to do was find the right code, modify it in any way I saw fit, and take my screenshots. | ||
| − | |||
| − | |||
| − | |||
| − | |||
==The Genetic Code, by Way of the Web== | ==The Genetic Code, by Way of the Web== | ||
| + | ===curl Command=== | ||
| + | curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | ||
| + | '''Notes''' | ||
*First I looked over a few basic curl commands to get a feel for how it works. | *First I looked over a few basic curl commands to get a feel for how it works. | ||
*I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script. | *I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script. | ||
*After some research, I started to fiddle wit the command line. | *After some research, I started to fiddle wit the command line. | ||
*To verify that my command was correct, I searched the the code that was returned by the terminal representing the amino acid chains and cross referenced them with the already known correct sequences. | *To verify that my command was correct, I searched the the code that was returned by the terminal representing the amino acid chains and cross referenced them with the already known correct sequences. | ||
| − | == | + | ==ExPASy Questions== |
| − | + | ===Question 1=== | |
| − | = | + | '''The server's response does have some links to other pages which include:''' |
| − | '''The server's response does have links to other pages | ||
*[http://web.expasy.org/css/sib_css/sib.css This] is a link to a page full of text resembling code and titled ''Swiss Institute of Bioinformatics''. | *[http://web.expasy.org/css/sib_css/sib.css This] is a link to a page full of text resembling code and titled ''Swiss Institute of Bioinformatics''. | ||
*[http://web.expasy.org/favicon.ico This] is a link to an their logo. | *[http://web.expasy.org/favicon.ico This] is a link to an their logo. | ||
| Line 23: | Line 26: | ||
*[http://en.wikipedia.org/wiki/Open_reading_frame This] is a link to a wikipedia page explaining Open reading frames as they pertain to biology. | *[http://en.wikipedia.org/wiki/Open_reading_frame This] is a link to a wikipedia page explaining Open reading frames as they pertain to biology. | ||
*[http://web.expasy.org/css/base.css This] link is similar to 1 and 3. Another text file, however this one is titles ''CSS for Genevian Resources''. | *[http://web.expasy.org/css/base.css This] link is similar to 1 and 3. Another text file, however this one is titles ''CSS for Genevian Resources''. | ||
| − | ===Just the Answers Using the Command Line=== | + | ===Question 2=== |
| + | '''There are identifiers in the ExPASy translation server’s responses which include:''' | ||
| + | * | ||
| + | '''Notes''' | ||
| + | ==Just the Answers Using the Command Line== | ||
| + | curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g' | ||
| + | '''Notes''' | ||
==Acknowledgements== | ==Acknowledgements== | ||
| − | * | + | *Thanks to Doctors Dahquist and Dondi to helping clarify the assignments instructions. |
*Thanks to "subfuzion' an account name for someone who helped me on gitHub. | *Thanks to "subfuzion' an account name for someone who helped me on gitHub. | ||
| − | * | + | *Special thanks to [[UserCazinge|Eddie Azinge]] and [[User:Bhamilton18|Blair Hamilton]]. With their help, I was able to learn what the "sed" command in curl was capable of. |
*Worked with partner to go over questions and complete assignment. | *Worked with partner to go over questions and complete assignment. | ||
*Although all those listed above contributed to my completing this work, all of its contents came from me alone. | *Although all those listed above contributed to my completing this work, all of its contents came from me alone. | ||
| Line 33: | Line 42: | ||
==References== | ==References== | ||
#LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3 | #LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3 | ||
| + | |||
{{simonwro120}} | {{simonwro120}} | ||
[[Category:Journal Entry]] | [[Category:Journal Entry]] | ||
Revision as of 10:23, 18 September 2017
Contents
Electronic Laboratory Notebook
Hack-a-Page
With DevTools
Without DevTools
Notes:
- First I accessed a website of my choosing and right clicked in Google Chrome to induce the dropdown menu.
- I then clicked on "Inspect" to bring up the developer tools.
- I then found a paragraph located next to a linked image and chose that part of the website as my target for modification.
- After that, all I had to do was find the right code, modify it in any way I saw fit, and take my screenshots.
The Genetic Code, by Way of the Web
curl Command
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
Notes
- First I looked over a few basic curl commands to get a feel for how it works.
- I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script.
- After some research, I started to fiddle wit the command line.
- To verify that my command was correct, I searched the the code that was returned by the terminal representing the amino acid chains and cross referenced them with the already known correct sequences.
ExPASy Questions
Question 1
The server's response does have some links to other pages which include:
- This is a link to a page full of text resembling code and titled Swiss Institute of Bioinformatics.
- This is a link to an their logo.
- This link is very similar to my first. Just another text page titled Swiss Institute of Bioinformatics.
- This is a link to a wikipedia page explaining Open reading frames as they pertain to biology.
- This link is similar to 1 and 3. Another text file, however this one is titles CSS for Genevian Resources.
Question 2
There are identifiers in the ExPASy translation server’s responses which include:
Notes
Just the Answers Using the Command Line
curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g'
Notes
Acknowledgements
- Thanks to Doctors Dahquist and Dondi to helping clarify the assignments instructions.
- Thanks to "subfuzion' an account name for someone who helped me on gitHub.
- Special thanks to Eddie Azinge and Blair Hamilton. With their help, I was able to learn what the "sed" command in curl was capable of.
- Worked with partner to go over questions and complete assignment.
- Although all those listed above contributed to my completing this work, all of its contents came from me alone.
References
- LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3
List of Assignments
Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15
List of Journal Entries
Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15
Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15
