Difference between revisions of "Emmatyrnauer Week 2"
From LMU BioDB 2017
Emmatyrnauer (talk | contribs) (replacing three letter abbreviation with one letter) |
Emmatyrnauer (talk | contribs) (labeling open reading frame) |
||
| Line 5: | Line 5: | ||
====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)==== | ====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)==== | ||
*stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T | *stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T | ||
| − | *K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I | + | *K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame) |
| − | *K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y | + | *K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame) |
==Complementary strand== | ==Complementary strand== | ||
| Line 13: | Line 13: | ||
5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ | 5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ | ||
====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)==== | ====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)==== | ||
| − | *R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L | + | *R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame) |
*V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F | *V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F | ||
*Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F | *Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F | ||
Revision as of 05:59, 11 September 2017
Contents
Strand Provided
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’
mRNA synthesized from this strand
3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)
- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T
- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame)
- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame)
Complementary strand
3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’
mRNA synthesized from this strand
5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)
- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame)
- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F
- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F