Difference between revisions of "Zvanysse Week 2"

From LMU BioDB 2017
Jump to: navigation, search
 
Line 1: Line 1:
 
[[Week_2| Week 2 Assignment Page]]
 
[[Week_2| Week 2 Assignment Page]]
 
+
==Original Strand==
 +
5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta - 3’
 
==Translating T's to U's==
 
==Translating T's to U's==
 
  5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’
 
  5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’
#+1 5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN
+
==Translating to Amino Acids==
#+2 5’ – V-C-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F – 3’
+
===+1===
#+3 5’ – Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F – 3’
+
5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN
 +
===+2===
 +
5’ – V-C-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F – 3’
 +
===+3===
 +
5’ – Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F – 3’
  
 
'''Complementary Strands'''
 
'''Complementary Strands'''
Line 11: Line 16:
 
  3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’
 
  3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’
 
'''Careful! Reading backwards'''
 
'''Careful! Reading backwards'''
#-1 --- Started with stop codon
+
===-1===
#-2 5’ – K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 3’ OPEN
+
5' -Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3'
#-3 5’ – K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 3’ OPEN
+
===-2===
 +
5’ – K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 3’ OPEN
 +
===-3===
 +
5’ – K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 3’ OPEN
  
 
==Acknowledgments==
 
==Acknowledgments==
 
*Worked with Corinne Wong on understanding how to read the DNA strands
 
*Worked with Corinne Wong on understanding how to read the DNA strands
*Used Wikipedia amino acids chart
+
*Emailed Dahlquist for clarification on the assignment
 +
[[User:Zvanysse|Zvanysse]] ([[User talk:Zvanysse|talk]]) 09:38, 11 September 2017 (PDT)
 
==References==
 
==References==
 
*LMU BioDB 2017. (2017). Week 2. Retrieved September 9, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
 
*LMU BioDB 2017. (2017). Week 2. Retrieved September 9, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
 +
*[http://2.bp.blogspot.com/-SW0Fnc0Bsb8/URutxvDAaEI/AAAAAAAAAVM/0rsFvgUug1k/s1600/url.jpg| Amino Acid Chart]

Latest revision as of 16:39, 11 September 2017

Week 2 Assignment Page

Original Strand

5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta - 3’

Translating T's to U's

5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’

Translating to Amino Acids

+1

5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN

+2

5’ – V-C-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F – 3’

+3

5’ – Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F – 3’

Complementary Strands

3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’

Careful! Reading backwards

-1

5' -Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3'

-2

5’ – K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 3’ OPEN

-3

5’ – K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 3’ OPEN

Acknowledgments

  • Worked with Corinne Wong on understanding how to read the DNA strands
  • Emailed Dahlquist for clarification on the assignment

Zvanysse (talk) 09:38, 11 September 2017 (PDT)

References