Difference between revisions of "Emmatyrnauer Week 2"
From LMU BioDB 2017
Emmatyrnauer (talk | contribs) m (syntax) |
Emmatyrnauer (talk | contribs) (→3 reading frames read 5' to 3' on the mRNA (+1,+2, +3): replacing 5' and 3' ends with N and C terminus) |
||
| Line 6: | Line 6: | ||
3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5' | 3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5' | ||
=====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)===== | =====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)===== | ||
| − | * | + | *N Ter- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T -C Ter |
| − | * | + | *N Ter- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I -C Ter (open reading frame) |
| − | * | + | *N Ter- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y -C Ter (open reading frame) |
===Complementary strand=== | ===Complementary strand=== | ||
Revision as of 16:15, 13 September 2017
Week 2 Individual Assignment
Strand Provided
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’
mRNA synthesized from this strand
3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)
*N Ter- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T -C Ter *N Ter- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I -C Ter (open reading frame) *N Ter- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y -C Ter (open reading frame)
Complementary strand
3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’
mRNA synthesized from this strand
5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)
*5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3' (open reading frame) *5'- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F -3' *3'- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F -3'
Acknowledgments
- I worked with my homework partner John Lopez in class. We met face-to-face one time outside of class.
- While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Emmatyrnauer (talk) 23:09, 10 September 2017 (PDT)
References
LMU BioDB 2017. (2017). Week 2. Retrieved September 10, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2