Revision as of 22:09, 12 September 2017

Edward Bachoura: Journal Week 2

Finding the Complimentary Strand

Original Strand

5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’

Complimentary Strand

3’- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5’

Translated Reading Frames

5’- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ - Bottom Strand of RNA

+3

5’- Y A N T M F R V STOP P S R Q F R W R H F -3’

+2

5’- V C STOP Y H V O R I T Q P P V P L A A F -3’

+1

5’- R M L I P C S A Y N P A A S S A G G I L -3’

-1

3’- A Y D Y G T R R I L G R R S R R P P STOP N -5’

-2

3’- H T I M V Q G A Y W V G G Q G D R R K -5’

-3

3’- I R L W Y K A H I G S A V K A T A V K -5’

Acknowledgements

Mary Balducci & I didn't have time to meet in person, but I texted her with my questions about reading frames.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

Ebachour (talk) 23:24, 11 September 2017 (PDT)

Navigate to the Rest of my Pages

Eddie Bachoura

Biological Databases Homepage

Assignment Pages

• Week 1
• Week 2
• Week 3
• Week 4
• Week 5
• Week 6
• Week 7
• Week 8
• Week 9
• Week 10
• Week 11
• Week 12
• Week 14
• Week 15

Journal Entries

• Journal Week 2
• Journal Week 3
• Journal Week 4
• Journal Week 5
• Journal Week 6
• Journal Week 7
• Journal Week 8
• Journal Week 9
• Journal Week 10
• Journal Week 11
• Journal Week 12
• Journal Week 14
• Journal Week 15

Shared Journal Entries

• Shared Journal Week 1
• Shared Journal Week 2
• Shared Journal Week 3
• Shared Journal Week 4
• Shared Journal Week 5
• Shared Journal Week 6
• Shared Journal Week 7
• Shared Journal Week 8
• Shared Journal Week 9
• Shared Journal Week 10
• Shared Journal Week 11
• Shared Journal Week 12
• Shared Journal Week 14
• Shared Journal Week 15