Difference between revisions of "Ebachour Week 2"
From LMU BioDB 2017
m |
(Added references) |
||
Line 23: | Line 23: | ||
'''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.''' | '''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.''' | ||
+ | [[User:Ebachour|Ebachour]] ([[User talk:Ebachour|talk]]) 15:43, 12 September 2017 (PDT) | ||
[[User:Ebachour|Ebachour]] ([[User talk:Ebachour|talk]]) 23:24, 11 September 2017 (PDT) | [[User:Ebachour|Ebachour]] ([[User talk:Ebachour|talk]]) 23:24, 11 September 2017 (PDT) | ||
+ | =References= | ||
+ | LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2 | ||
{{Template: Ebachour}} | {{Template: Ebachour}} |
Latest revision as of 22:43, 12 September 2017
Contents
Edward Bachoura: Journal Week 2
Finding the Complimentary Strand
Original Strand
5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’
Complimentary Strand
3’- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5’
Translated Reading Frames
5’- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ - Bottom Strand of RNA
+3
5’- Y A N T M F R V STOP P S R Q F R W R H F -3’
+2
5’- V C STOP Y H V O R I T Q P P V P L A A F -3’
+1
5’- R M L I P C S A Y N P A A S S A G G I L -3’
-1
3’- A Y D Y G T R R I L G R R S R R P P STOP N -5’
-2
3’- H T I M V Q G A Y W V G G Q G D R R K -5’
-3
3’- I R L W Y K A H I G S A V K A T A V K -5’
Acknowledgements
Mary Balducci & I didn't have time to meet in person, but I texted her with my questions about reading frames.
While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source. Ebachour (talk) 15:43, 12 September 2017 (PDT)
Ebachour (talk) 23:24, 11 September 2017 (PDT)
References
LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
Assignment Pages
- Week 1
- Week 2
- Week 3
- Week 4
- Week 5
- Week 6
- Week 7
- Week 8
- Week 9
- Week 10
- Week 11
- Week 12
- Week 14
- Week 15
Journal Entries
- Journal Week 2
- Journal Week 3
- Journal Week 4
- Journal Week 5
- Journal Week 6
- Journal Week 7
- Journal Week 8
- Journal Week 9
- Journal Week 10
- Journal Week 11
- Journal Week 12
- Journal Week 14
- Journal Week 15
Shared Journal Entries
- Shared Journal Week 1
- Shared Journal Week 2
- Shared Journal Week 3
- Shared Journal Week 4
- Shared Journal Week 5
- Shared Journal Week 6
- Shared Journal Week 7
- Shared Journal Week 8
- Shared Journal Week 9
- Shared Journal Week 10
- Shared Journal Week 11
- Shared Journal Week 12
- Shared Journal Week 14
- Shared Journal Week 15