Revision as of 20:59, 17 September 2017

Hacking a Page

With Developer Tools

Without Developer Tools

The Genetic Code

curl command

curl -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa

Question responses

1. The links within ExPASy's translation server's responses are "main.css," "ga.js," and "dna_aa." They go to more sources of code for the website's process.
2. The identifiers are: "textarea name=pre_text," which gives the location of where the input goes, and "action=/cgi-bin/translate/dna_aa," which gives the command of translating the given input. There are also other identifiers that alter the settings, which would give different outputs. "select name=output" decides the format of the output, and "select name=code" informs what kind of genetic code it is.

Commands that extract just the answers

curl -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa | sed "1,47d" | sed 's/<[^>]*>//g' | sed "14,50d" | sed "s/[A-E G-Z]/& /g" | sed "s/-/STOP /g" | sed "s/M/Met/g"

Notebook

Hacking a Page

For the hacking a page assignment, I went to Netflix and clicked right clicked over the main image and then clicked on "investigate." I moved my mouse over the code for the webpage until I found the image/text I wanted to replace and pasted the link to the image or typed in the text I wanted to add.

curl

We used "curl -d" to enter in the desired text for the text area and then commanded submit. To get rid of the extra code, we deleted the lines before and after the desired section and the extra stuff between brackets. We added spaces between the amino acid sequences, changed "-" to "STOP" and "M" to "Met."

Acknowledgments

1. I met with my partner, Arash Lari, and we worked together on the curl section of the week 3 assignment.

References

1. LMU BioDB 2017. (2017). Week 3. Retrieved September 12, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3
2. Netflix. (2017). Retrieved September 16, 2017, from https://www.netflix.com/

cwong34

BIOL/CMSI 367-01: Biological Databases Fall 2017

Assignments

• Week 1
• Week 2
• Week 3
• Week 4
• Week 5
• Week 6
• Week 7
• Week 8
• Week 9
• Week 10
• Week 11
• Week 12
• Week 14
• Week 15

Journal Entries:

• cwong34 Week 2
• cwong34 Week 3
• cwong34 Week 4
• cwong34 Week 5
• cwong34 Week 6
• cwong34 Week 7
• cwong34 Week 8
• cwong34 Week 9
• cwong34 Week 10
• cwong34 Week 11
• cwong34 Week 12
• cwong34 Week 14
• cwong34 Week 15

Shared Journals:

• cwong34 Week 1 Journal
• cwong34 Week 2 Journal
• cwong34 Week 3 Journal
• cwong34 Week 4 Journal
• cwong34 Week 5 Journal
• cwong34 Week 6 Journal
• cwong34 Week 7 Journal
• cwong34 Week 8 Journal
• cwong34 Week 9 Journal
• cwong34 Week 10 Journal

Group Project

• Gene hAPI
• Gene hAPI Deliverables

Cwong34 (talk) 13:59, 17 September 2017 (PDT)