Revision as of 08:42, 18 September 2017

Electronic Laboratory Notebook

Hack-a-Page

• First I accessed a website of my choosing and right clicked in Google Chrome to induce the dropdown menu.
• I then clicked on "Inspect" to bring up the developer tools.
• I then found a paragraph located next to a linked image and chose that part of the website as my target for modification.
• After that, all I had to do was find the right code, modify it in any way I saw fit, and take my screenshots.

With DevTools|right

Without DevTools

The Genetic Code, by Way of the Web

• First I looked over a few basic curl commands to get a feel for how it works.
• I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script.
• After some research, I started to fiddle wit the command line.
• To verify that my command was correct, I searched the URL's representing the amino acid chains in the code that was returned by the terminal and cross referenced them with the already known correct sequences.

cURL command

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

Study the curl'ed code

Using the Command Line to Extract Just the Answers

Acknowledgements

References

List of Assignments

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15

List of Journal Entries

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15

List of Shared Journals

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15