Difference between revisions of "Simonwro120 Week 3"
From LMU BioDB 2017
Simonwro120 (talk | contribs) (added notes and curl command) |
Simonwro120 (talk | contribs) (added notes and curl command) |
||
Line 13: | Line 13: | ||
*I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script. | *I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script. | ||
*After some research, I started to fiddle wit the command line. | *After some research, I started to fiddle wit the command line. | ||
− | *To verify that my command was correct, I searched the | + | *To verify that my command was correct, I searched the the code that was returned by the terminal representing the amino acid chains and cross referenced them with the already known correct sequences. |
===cURL command=== | ===cURL command=== | ||
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa |
Revision as of 09:03, 18 September 2017
Contents
Electronic Laboratory Notebook
Hack-a-Page
- First I accessed a website of my choosing and right clicked in Google Chrome to induce the dropdown menu.
- I then clicked on "Inspect" to bring up the developer tools.
- I then found a paragraph located next to a linked image and chose that part of the website as my target for modification.
- After that, all I had to do was find the right code, modify it in any way I saw fit, and take my screenshots.
With DevTools|right
Without DevTools
The Genetic Code, by Way of the Web
- First I looked over a few basic curl commands to get a feel for how it works.
- I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script.
- After some research, I started to fiddle wit the command line.
- To verify that my command was correct, I searched the the code that was returned by the terminal representing the amino acid chains and cross referenced them with the already known correct sequences.
cURL command
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
Study the curl
'ed code
Using the Command Line to Extract Just the Answers
Acknowledgements
References
List of Assignments
Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15
List of Journal Entries
Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15
Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15