Difference between revisions of "Simonwro120 Week 3"
From LMU BioDB 2017
Simonwro120 (talk | contribs) (Answered Q1) |
Simonwro120 (talk | contribs) m (syntax fix) |
||
| Line 17: | Line 17: | ||
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | ||
===ExPASy Questions=== | ===ExPASy Questions=== | ||
| − | '''The server's response does have links to other pages including:''' | + | #'''The server's response does have links to other pages including:''' |
| − | + | *[http://web.expasy.org/css/sib_css/sib.css This] is a link to a page full of text resembling code and titled ''Swiss Institute of Bioinformatics''. | |
| − | + | *[http://web.expasy.org/favicon.ico This] is a link to an their logo. | |
| − | + | *[http://web.expasy.org/css/sib_css/sib_print.css This] link is very similar to my first. Just another text page titled ''Swiss Institute of Bioinformatics''. | |
| − | + | *[http://en.wikipedia.org/wiki/Open_reading_frame This] is a link to a wikipedia page explaining Open reading frames as they pertain to biology. | |
| − | + | *[http://web.expasy.org/css/base.css This] link is similar to 1 and 3. Another text file, however this one is titles ''CSS for Genevian Resources''. | |
===Using the Command Line to Extract Just the Answers=== | ===Using the Command Line to Extract Just the Answers=== | ||
==Acknowledgements== | ==Acknowledgements== | ||
Revision as of 09:36, 18 September 2017
Contents
Electronic Laboratory Notebook
Hack-a-Page
- First I accessed a website of my choosing and right clicked in Google Chrome to induce the dropdown menu.
- I then clicked on "Inspect" to bring up the developer tools.
- I then found a paragraph located next to a linked image and chose that part of the website as my target for modification.
- After that, all I had to do was find the right code, modify it in any way I saw fit, and take my screenshots.
With DevTools|right
Without DevTools
The Genetic Code, by Way of the Web
- First I looked over a few basic curl commands to get a feel for how it works.
- I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script.
- After some research, I started to fiddle wit the command line.
- To verify that my command was correct, I searched the the code that was returned by the terminal representing the amino acid chains and cross referenced them with the already known correct sequences.
cURL command
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
ExPASy Questions
- The server's response does have links to other pages including:
- This is a link to a page full of text resembling code and titled Swiss Institute of Bioinformatics.
- This is a link to an their logo.
- This link is very similar to my first. Just another text page titled Swiss Institute of Bioinformatics.
- This is a link to a wikipedia page explaining Open reading frames as they pertain to biology.
- This link is similar to 1 and 3. Another text file, however this one is titles CSS for Genevian Resources.
Using the Command Line to Extract Just the Answers
Acknowledgements
References
List of Assignments
Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15
List of Journal Entries
Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15
Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15
