Revision as of 09:52, 18 September 2017

Electronic Laboratory Notebook

Hack-a-Page

• First I accessed a website of my choosing and right clicked in Google Chrome to induce the dropdown menu.
• I then clicked on "Inspect" to bring up the developer tools.
• I then found a paragraph located next to a linked image and chose that part of the website as my target for modification.
• After that, all I had to do was find the right code, modify it in any way I saw fit, and take my screenshots.

With DevTools|right

Without DevTools

The Genetic Code, by Way of the Web

• First I looked over a few basic curl commands to get a feel for how it works.
• I then searched for commands that would allow for user input, as well ass a command that would allow me to activate a button most likely associated to some kind of script.
• After some research, I started to fiddle wit the command line.
• To verify that my command was correct, I searched the the code that was returned by the terminal representing the amino acid chains and cross referenced them with the already known correct sequences.

cURL command

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

ExPASy Questions

The server's response does have links to other pages including:

• This is a link to a page full of text resembling code and titled Swiss Institute of Bioinformatics.
• This is a link to an their logo.
• This link is very similar to my first. Just another text page titled Swiss Institute of Bioinformatics.
• This is a link to a wikipedia page explaining Open reading frames as they pertain to biology.
• This link is similar to 1 and 3. Another text file, however this one is titles CSS for Genevian Resources.

Just the Answers Using the Command Line

Acknowledgements

• Special Thanks to Doctors Dahquist and Dondi to helping clarify the assignments instructions.
• Thanks to "subfuzion' an account name for someone who helped me on gitHub.
• Thanks to Blair Hamilton. With her help, I was able to learn what the "sed" command in curl.
• Worked with partner to go over questions and complete assignment.
• Although all those listed above contributed to my completing this work, all of its contents came from me alone.

References

1. LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3

List of Assignments

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15

List of Journal Entries

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15

List of Shared Journals

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15