Difference between revisions of "Emmatyrnauer Week 3"
Emmatyrnauer (talk | contribs) (→Acknowledgements: added location i used to hack) |
Emmatyrnauer (talk | contribs) (→References: adding another reference) |
||
Line 45: | Line 45: | ||
==References== | ==References== | ||
− | LMU BioDB 2017. (2017). Week 3. Retrieved September 18, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3 | + | #Wikipedia:Picture tutorial. Retrieved September 18, 2017, from https://en.wikipedia.org/wiki/Wikipedia:Picture_tutorial |
+ | #LMU BioDB 2017. (2017). Week 3. Retrieved September 18, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3 |
Revision as of 04:25, 20 September 2017
Contents
Hack a Page
Text Modification
Picture Replacement
Notebook
For this portion of the assignment, I visited the LMU website and replaced "Loyola Marymount University" with "Where the kool kidz go." I also changed the picture associated with the heading: "Top 10% Wallstreet Journal Ranked" to a picture of my dog. To replace the heading I opened up the developer tools using the inspect option and typed in the new heading. For the photo, I went to my Facebook page and copied and pasted the src from Facebook to the developer tools on LMU's website.
The Genetic Code by Way of the Web
DMing the Server with Curl
curl -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa
Studying the curled code
Are there any links to other pages within the ExPASy translation server’s responses? List them and state where they go. (of course, if you aren’t sure, you can always go there with a web browser or curl)
sib.css | website display bas.css | website display sib_print.css | website display ga.js | javascript dna_aa | genetic transcription processes
Are there any identifiers in the ExPASy translation server’s responses? List them and state what you think they identify.
/cgi-bin/translate/dna_aa | identifier for what type of action is performed pre_text | identifier for location of text box "POST | identifier for form method
Using the Command Line to Extract Just the Answers
curl -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa | sed "1,47d" | sed "14,44d" | sed 's/<[^>]*>//g' | sed "2s/[A-Z]/& /g" | sed "4s/[A-Z]/& /g" | sed "6s/[A-Z]/& /g" | sed "8s/[A-Z]/& /g" | sed "10s/[A-Z]/& /g" | sed "12s/[A-Z]/& /g" | sed "s/M/Met/g"| sed "s/-/Stop /g"
Notebook
In DMing the server with curl, I used the curl -d function to copy how the website performs the transcription process and used "pre_text=" from the the developer tools before the DNA sequence since that is the code that was used on ExPASy where the input goes. Zachary showed me how to use "&submit=Submit" at the end of the command, and all of this was followed by the action on the ExPASy developer tools. In extracting just the information needed, I used the sed command to get rid of the information before and after the mRNA that was produced from the initial command. The sed command was then used to replace all of the material between <> with nothing, and to put spaces between each of the amino acid abbreviations. Finally, the sed command was used to replace "M" with "Met" and "s" with "Stop."
Acknowledgements
- I worked with my homework partner Zachary Van Ysseldyk outside of class. We met up and he helped me understand the curl command and how to do the individual assignment.
- I hacked LMU's website
- While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Emmatyrnauer (talk) 12:03, 18 September 2017 (PDT)
References
- Wikipedia:Picture tutorial. Retrieved September 18, 2017, from https://en.wikipedia.org/wiki/Wikipedia:Picture_tutorial
- LMU BioDB 2017. (2017). Week 3. Retrieved September 18, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3