Difference between revisions of "Aporras1 Week 3"
From LMU BioDB 2017
(added curl code) |
(→References: added 4th reference) |
||
Line 31: | Line 31: | ||
#Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm | #Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm | ||
#Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017]. | #Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017]. | ||
+ | #xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017]. |
Revision as of 06:19, 20 September 2017
User Page: Antonio Porras
Assignment Page: Week 3
Contents
Electronic Notebook Link
"Hacked" Page with Developer Tools Visible
"Hacked" Page without Developer Tools Visible
DMing the Server with curl
Final curl code:
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
Acknowledgements
- Met outside of class with Simon Wroblewski to discuss any questions we had prior to meeting and throughout the process of completing the Week 3 assignment.
While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Aporras1 (talk) 16:18, 17 September 2017 (PDT)
References
- Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size
- Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm
- Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].
- xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].