Difference between revisions of "Aporras1 Week 3"

Revision as of 06:20, 20 September 2017

User Page: Antonio Porras

Assignment Page: Week 3

Electronic Notebook Link

Electronic Notebook

"Hacked" Page with Developer Tools Visible

"Hacked" Page without Developer Tools Visible

DMing the Server with curl

Final curl code:

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

Acknowledgements

1. Met outside of class with Simon Wroblewski to discuss any questions we had prior to meeting and throughout the process of completing the Week 3 assignment.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

Aporras1 (talk) 16:18, 17 September 2017 (PDT)

References

1. Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size
2. Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm
3. Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].
4. xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].
5. LMU BioDB 2017. (2017). Week 3. Retrieved September 16, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3