Difference between revisions of "Aporras1 Week 3"
From LMU BioDB 2017
(→References: added 4th reference) |
(added study the curl'ed code from notebook) |
||
| Line 19: | Line 19: | ||
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | ||
| + | |||
| + | ==Study the curl'ed Code== | ||
| + | '''Question 1:''' | ||
| + | #http://www.w3.org/TR/html4/loose.dtd : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures." | ||
| + | #http://web.expasy.org/favicon.ico : The logo for Expasy. | ||
| + | #http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics. | ||
| + | #https://www.expasy.org : The Expasy Bioinformatics Resource Portal. | ||
| + | #http://web.expasy.org/translate/ : Expasy translation tool. | ||
| + | #https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as. | ||
| + | #https://www.expasy.org/disclaimer.html : Expasy disclaimer. | ||
==Acknowledgements== | ==Acknowledgements== | ||
Revision as of 06:28, 20 September 2017
User Page: Antonio Porras
Assignment Page: Week 3
Contents
Electronic Notebook Link
"Hacked" Page with Developer Tools Visible
"Hacked" Page without Developer Tools Visible
DMing the Server with curl
Final curl code:
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&Submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
Study the curl'ed Code
Question 1:
- http://www.w3.org/TR/html4/loose.dtd : Described as "the HTML 4.01 Transitional DTD, which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures."
- http://web.expasy.org/favicon.ico : The logo for Expasy.
- http://www.sib.swiss : The main web page for Swiss Institute of Bioinformatics.
- https://www.expasy.org : The Expasy Bioinformatics Resource Portal.
- http://web.expasy.org/translate/ : Expasy translation tool.
- https://en.wikipedia.org/wiki/Open_reading_frame : Wikipedia link to what an "open reading frame" is described as.
- https://www.expasy.org/disclaimer.html : Expasy disclaimer.
Acknowledgements
- Met outside of class with Simon Wroblewski to discuss any questions we had prior to meeting and throughout the process of completing the Week 3 assignment.
While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Aporras1 (talk) 16:18, 17 September 2017 (PDT)
References
- Help:How to use images. (2016, December 06). Retrieved September 18, 2017, from https://simple.wikipedia.org/wiki/Help:How_to_use_images#Size
- Linux curl command help and examples. (2017, June 30). Retrieved September 19, 2017, from https://www.computerhope.com/unix/curl.htm
- Curl.haxx.se. (2017). curl - Tutorial. [online] Available at: https://curl.haxx.se/docs/httpscripting.html [Accessed 20 Sep. 2017].
- xpasy.org. (2017). ExPASy: SIB Bioinformatics Resource Portal - Home. [online] Available at: https://www.expasy.org [Accessed 20 Sep. 2017].
- LMU BioDB 2017. (2017). Week 3. Retrieved September 16, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3
