Difference between revisions of "Emmatyrnauer Week 2"
From LMU BioDB 2017
Emmatyrnauer (talk | contribs) (labeling open reading frame) |
Emmatyrnauer (talk | contribs) (Acknowledgements and References added) |
||
| Line 1: | Line 1: | ||
| − | ==Strand Provided== | + | |
| + | ==Week 2 Individual Assignment== | ||
| + | ===Strand Provided=== | ||
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’ | 5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’ | ||
| − | ===mRNA synthesized from this strand=== | + | ====mRNA synthesized from this strand==== |
3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5' | 3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5' | ||
| − | ====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)==== | + | =====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)===== |
*stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T | *stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T | ||
*K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame) | *K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame) | ||
*K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame) | *K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame) | ||
| − | ==Complementary strand== | + | ===Complementary strand=== |
3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’ | 3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’ | ||
| − | ===mRNA synthesized from this strand=== | + | ====mRNA synthesized from this strand==== |
5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ | 5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ | ||
| − | ====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)==== | + | =====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)===== |
*R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame) | *R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame) | ||
*V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F | *V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F | ||
*Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F | *Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F | ||
| + | |||
| + | ==Acknowledgments== | ||
| + | #I worked with my homework partner [[User:Johnllopez616|John Lopez]] in class. We met face-to-face one time outside of class. | ||
| + | #While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source. | ||
| + | [[User:Emmatyrnauer|Emmatyrnauer]] ([[User talk:Emmatyrnauer|talk]]) 23:09, 10 September 2017 (PDT) | ||
| + | ==References== | ||
| + | LMU BioDB 2017. (2017). Week 2. Retrieved September 10, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2 | ||
Revision as of 06:09, 11 September 2017
Week 2 Individual Assignment
Strand Provided
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’
mRNA synthesized from this strand
3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)
- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T
- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame)
- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame)
Complementary strand
3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’
mRNA synthesized from this strand
5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)
- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame)
- V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F
- Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F
Acknowledgments
- I worked with my homework partner John Lopez in class. We met face-to-face one time outside of class.
- While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Emmatyrnauer (talk) 23:09, 10 September 2017 (PDT)
References
LMU BioDB 2017. (2017). Week 2. Retrieved September 10, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
