Difference between revisions of "Emmatyrnauer Week 2"
From LMU BioDB 2017
Emmatyrnauer (talk | contribs) (Acknowledgements and References added) |
Emmatyrnauer (talk | contribs) (fixing syntax) |
||
| Line 2: | Line 2: | ||
==Week 2 Individual Assignment== | ==Week 2 Individual Assignment== | ||
===Strand Provided=== | ===Strand Provided=== | ||
| − | 5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’ | + | 5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’ |
====mRNA synthesized from this strand==== | ====mRNA synthesized from this strand==== | ||
| − | 3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5' | + | 3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5' |
=====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)===== | =====3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)===== | ||
*stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T | *stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T | ||
| Line 11: | Line 11: | ||
===Complementary strand=== | ===Complementary strand=== | ||
| − | 3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’ | + | 3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’ |
====mRNA synthesized from this strand==== | ====mRNA synthesized from this strand==== | ||
| − | 5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ | + | 5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ |
=====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)===== | =====3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)===== | ||
| − | *R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame) | + | *R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame) |
| − | *V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F | + | *V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F |
| − | *Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F | + | *Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F |
==Acknowledgments== | ==Acknowledgments== | ||
Revision as of 02:16, 12 September 2017
Week 2 Individual Assignment
Strand Provided
5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’
mRNA synthesized from this strand
3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)
- stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T
- K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame)
- K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame)
Complementary strand
3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’
mRNA synthesized from this strand
5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’
3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)
*R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame) *V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F *Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F
Acknowledgments
- I worked with my homework partner John Lopez in class. We met face-to-face one time outside of class.
- While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Emmatyrnauer (talk) 23:09, 10 September 2017 (PDT)
References
LMU BioDB 2017. (2017). Week 2. Retrieved September 10, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
