Difference between revisions of "Dbashour week 2"
From LMU BioDB 2017
(DNA and Contemporary DNA strand created) |
(added translations and reading frames) |
||
| Line 1: | Line 1: | ||
| − | DNA strand | + | ==DNA== |
| + | ===DNA strand=== | ||
5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’ | 5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’ | ||
| − | Contemporary DNA Strand | + | ===Contemporary DNA Strand=== |
3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5' | 3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5' | ||
| + | ==Translations== | ||
| + | ===+1=== | ||
| + | 5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3' | ||
| + | ===+2=== | ||
| + | 5'- V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F -3' | ||
| + | ===+3=== | ||
| + | 5'- Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F -3' | ||
| + | ===-1=== | ||
| + | 3' Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3' | ||
| + | ===-2=== | ||
| + | 3’ K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 5’ | ||
| + | ===-3=== | ||
| + | 3’ K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 5’ | ||
| + | ==Open Reading Frames== | ||
| + | +1, -2, -3 are all open reading frames | ||
Revision as of 04:44, 12 September 2017
Contents
DNA
DNA strand
5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
Contemporary DNA Strand
3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
Translations
+1
5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3'
+2
5'- V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F -3'
+3
5'- Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F -3'
-1
3' Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3'
-2
3’ K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 5’
-3
3’ K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 5’
Open Reading Frames
+1, -2, -3 are all open reading frames