Zvanysse Week 2

Week 2 Assignment Page

Translating T's to U's

5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’

1. +1 5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN
2. +2 5’ – V-C-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F – 3’
3. +3 5’ – Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F – 3’

Complementary Strands

3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’

Careful! Reading backwards

1. -1 --- Started with stop codon
2. -2 5’ – K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 3’ OPEN
3. -3 5’ – K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 3’ OPEN

Acknowledgments

• Worked with Corinne Wong on understanding how to read the DNA strands
• Used Wikipedia amino acids chart

References

• LMU BioDB 2017. (2017). Week 2. Retrieved September 9, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2