Emmatyrnauer Week 2

From LMU BioDB 2017
Revision as of 05:59, 11 September 2017 by Emmatyrnauer (talk | contribs) (labeling open reading frame)
Jump to: navigation, search

Strand Provided

5'- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’

mRNA synthesized from this strand

3'- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'

3 reading frames read 5' to 3' on the mRNA (+1,+2, +3)

  • stop-N-A-A-S-G-T-G-G-W-V-I-R-G-T-G-Y-stop-H-T
  • K-M-P-P-A-glu-L-A-A-G-L-Y-A-E-H-G-I-S-I (open reading frame)
  • K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y (open reading frame)

Complementary strand

3’- gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat -5’

mRNA synthesized from this strand

5'- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’

3 reading frames read 5' to 3' on the mRNA (-1, -2, -3)

  • R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L (open reading frame)
  • V-C-stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F
  • Y-A-N-T-M-F-R-V-stop-P-S-R-Q-F-R-W-R-H-F