Zvanysse Week 2
From LMU BioDB 2017
								
												
				First, we must write the complementary DNA strand then change the T's into U's.
Translating T's to U's
5’ – cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua – 3’
- +1 5’- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L – 3’ OPEN
- +2 5’ – V-C – 3’
- +3 5’ – Y-A-N-T-M-F-R-V – 3’
Complementary Strands
3’ – gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau - 5’
Careful! Reading backwards
- -1 --- Started with stop codon
- -2 5’ – K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 3’ OPEN
- -3 5’ – K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 3’ OPEN
Acknowledgments
- Worked with Corinne Wong on understanding how to read the DNA strands
- Used Wikipedia amino acids chart
References
- LMU BioDB 2017. (2017). Week 2. Retrieved September 9, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2

