Aporras1 Electronic Notebook

Week 2

5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3' Template DNA strand (Top Strand)
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5' Complimentary DNA Strand (Bottom Strand)

3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5' RNA Strand (Top Strand)

5'-cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua-3' RNA Strand (Bottom Strand)

• Completed letter by letter strand of the complimentary DNA using the template strand
• Made two RNA strands using the 5' to 3' DNA strand and the 3' to 5' DNA strand
  • changed T to U on the RNA strands

RNA Strand (Top Strand) Reading Frames

• Put 1 single space every 3 codons starting after a, after c, and after g to create the 3 different reading frames

(-1) 3'-gca uac gau uau ggu aca agg cgc aua uug ggu cgg cgg uca agg cga ccg ccg uaa aau-5'
A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-STOP-N

(-2) 3'-g cau acg auu aug gua caa ggc gca uau ugg guc ggc ggu caa ggc gac cgc cgu aaa au-5'
g-H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K-au

(-3) 3'-gc aua cga uua ugg uac aag gcg cau auu ggg ucg gcg guc aag gcg acc gcc gua aaa u-5'
gc-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-u

RNA Strand (Bottom Strand)

• Put 1 single space every 3 codons starting after a, after c, and after g to create the 3 different reading frames

(+1) 5'-cgu aug cua aua cca ugu ucc gcg uau aac cca gcc gcc agu ucc gcu ggc ggc auu uua-3'
R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L

(+2) 5'-c gua ugc uaa uac cau guu ccg cgu aua acc cag ccg cca guu ccg cug gcg gca uuu ua-3'
c-V-C-STOP-Y-H-V-O-R-I-T-Q-P-P-V-P-L-A-A-F-ua

(+3) 5'-cg uau gcu aau acc aug uuc cgc gua uaa ccc agc cgc cag uuc cgc ugg cgg cau uuu a-3'
cg-Y-A-N-T-M-F-R-V-STOP-P-S-R-Q-F-R-W-R-H-F-a

Week 3

For the week 3 I chose the front page of [Fox News] to "hack" and change the source code.

Used "developer tools" in Google Chrome

1. I changed 3 links underneath the main header.
2. Uploaded an image of a teddy bear hamster to the LMU BioDB 2017.
3. Changed the src code to the image of the hamster.
4. Changed the header.
5. Changed the header within the image.

"Hacked" Page with Developer Tools

"Hacked" Page without Developer Tools

DMing the Server with curl

1. Used curl command in terminal and found the line when inspecting the text box: <form method=POST action="/cgi-bin/translate/dna_aa">
2. Inspected the button which resulted in translating the sequence: <input type="submit" value="TRANSLATE SEQUENCE">
3. Inspected the text box: <textarea name="pre_text" rows="15" cols="70"></textarea>
4. Inferring from the code mentioned prior, the text within the box is known as "pre_text".
5. Looked at various curl codes and found curl -d sends data as a POST as if the user has filled out certain forms. The examples used: -d name=Antonio if I was putting my name into a form.
6. First attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" which did not work.
7. Second attempt: curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta" https://expasy.org/translate