Ebachour Week 2
From LMU BioDB 2017
Contents
Edward Bachoura: Journal Week 2
Finding the Complimentary Strand
Original Strand
5’- cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta -3’
Complimentary Strand
3’- gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5’
Translated Reading Frames
5’- cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua -3’ - Bottom Strand of RNA
+3
5’- Y A N T M F R V STOP P S R Q F R W R H F -3’
+2
5’- V C STOP Y H V O R I T Q P P V P L A A F -3’
+1
5’- R M L I P C S A Y N P A A S S A G G I L -3’
-1
3’- A Y D Y G T R R I L G R R S R R P P STOP N -5’
-2
3’- H T I M V Q G A Y W V G G Q G D R R K -5’
-3
3’- I R L W Y K A H I G S A V K A T A V K -5’
Acknowledgements
Mary Balducci & I didn't have time to meet in person, but I texted her with my questions about reading frames.
While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
