ILT1/YDR090C Week 3 - Revision history

Icrespin: forgot to add journal entry

2019-10-10T03:59:31Z

forgot to add journal entry

Icrespin: /* References */ added week 3 link

2019-09-17T23:39:29Z

‎References: added week 3 link

Icrespin: /* Additional Information */ added info on presentation

2019-09-17T23:37:33Z

‎Additional Information: added info on presentation

Icrespin: /* Additional Information */ added info on content

2019-09-17T23:21:38Z

‎Additional Information: added info on content

Icrespin: /* Additional Information */ added info

2019-09-17T23:17:07Z

‎Additional Information: added info

Icrespin: /* Additional Information */ added more info

2019-09-17T22:57:08Z

‎Additional Information: added more info

Knguye66: add bullet

2019-09-17T22:56:08Z

add bullet

Knguye66: dna sequence reformatting

2019-09-17T22:51:26Z

dna sequence reformatting

Knguye66: change px

2019-09-17T22:50:34Z

change px

Knguye66: add more to summary

2019-09-17T22:49:37Z

add more to summary

← Older revision		Revision as of 03:59, 10 October 2019
Line 66:		Line 66:
	* Extended image syntax. (2019, July 6). Retrieved from https://en.wikipedia.org/wiki/Wikipedia:Extended_image_syntax		* Extended image syntax. (2019, July 6). Retrieved from https://en.wikipedia.org/wiki/Wikipedia:Extended_image_syntax
	* Hyperlink. (2019, September 8). Retrieved from https://en.wikipedia.org/wiki/Hyperlink		* Hyperlink. (2019, September 8). Retrieved from https://en.wikipedia.org/wiki/Hyperlink
		+
		+	[[Category:Journal Entry]]

@@ Line 59: / Line 59: @@
 * SIB Swiss Institute of Bioinformatics. (n.d.). SIB Swiss Institute of Bioinformatics. Retrieved from https://web.expasy.org/translate/
 * UniProt ConsortiumEuropean Bioinformatics InstituteProtein Information ResourceSIB Swiss Institute of Bioinformatics. (2019, May 8). Uncharacterized membrane protein YDR090C. Retrieved from https://www.uniprot.org/uniprot/Q03193
 * YDR090C hypothetical protein [Saccharomyces cerevisiae S288C] - Gene - NCBI. (n.d.). Retrieved from https://www.ncbi.nlm.nih.gov/gene/851664

@@ Line 35: / Line 35: @@
 *There weren't many big differences in the content between each of the databases. For instance, NCBI showed assumed gene sequence. Also, there was more information displayed in NCBI compare to anything else. Since this is a gene that is missing a lot of information due to lack of research, most databases provide about the exact same information. Each one consists of the SGD ID and lineage. The function type from each database is the same. There aren't huge differences that can be displayed.
 '''Were there differences in presentation of the information?'''
+* The differences in presentation was the different color schemes between the databases. For example, UniProt has this very bright blue color, whereas NCBI is this gray color. SGD seems to be the only database that tends to be very straightforward on the information. It is to the point and big enough for specific information. UniProt is another database that can be used easily and has a great representation.
 '''Why did you choose your particular gene? i.e., why is it interesting to you and your partner?'''
 * This particular gene was chosen because much of its information has yet to be discovered. It is a protein with unknown function and very few research has been conducted and found on this gene. This sparked interest to us because it highlighted the very point of science and why we are biology majors: to discover (using research and evidence) to further identify and/or understand a distinct mechanism, organism, and/or gene.

@@ Line 33: / Line 33: @@
 '''What was different about the information provided about your gene in each of the parent databases?'''
 '''Were there differences in content, the information or data itself?'''
-*There weren't many big differences in the content between each of the databases. For instance, NCBI showed assumed gene sequence.
+*There weren't many big differences in the content between each of the databases. For instance, NCBI showed assumed gene sequence. Also, there was more information displayed in NCBI compare to anything else. Since this is a gene that is missing a lot of information due to lack of research, most databases provide about the exact same information. Each one consists of the SGD ID and lineage. The function type from each database is the same. There aren't huge differences that can be displayed.
 '''Were there differences in presentation of the information?'''
+*

@@ Line 33: / Line 33: @@
 '''What was different about the information provided about your gene in each of the parent databases?'''
 '''Were there differences in content, the information or data itself?'''
-*The differences in content was very similar with each other. For instance, NCBI showed assumed gene sequence.
+*There weren't many big differences in the content between each of the databases. For instance, NCBI showed assumed gene sequence.
 '''Were there differences in presentation of the information?'''
+*

@@ Line 15: / Line 15: @@
 ** Uniprot - Q03193 (YD090_YEAST) - ''For more information, visit [https://www.uniprot.org/uniprot/Q03193/ UniProtKB]''
 '''What is the DNA sequence of your gene?'''
-* ATGATCTCTGAAAAGGCTGCTACCGCTTTAGCTACTATAGCAACAGTTTGCTGGTGTGTCCAGCTAATTCCGCAAAT
+ ATGATCTCTGAAAAGGCTGCTACCGCTTTAGCTACTATAGCAACAGTTTGCTGGTGTGTCCAGCTAATTCCGCAAAT
-:AATATATAATTGGAAAAAAAAGGACTGTACGGGGCTGCCACCACTGATGATGTTCCTCTGGGTTGTTTCCGGAATTCCAT
+ AATATATAATTGGAAAAAAAAGGACTGTACGGGGCTGCCACCACTGATGATGTTCCTCTGGGTTGTTTCCGGAATTCCAT
-:TTGCCATATATTTCTGTGTTAGTAAAGGTAATGTCATTTTACAAGTTCAACCACACCTTTTTATGTTCTTCTGTTCTATA
+ TTGCCATATATTTCTGTGTTAGTAAAGGTAATGTCATTTTACAAGTTCAACCACACCTTTTTATGTTCTTCTGTTCTATA
-:AGTTTCGTCCAATCGTGTTATTATCCACCAATCAGTATGGCGAGATCCAAAATAGTAATGATTGTAGCTGCTATTATTGC
+ AGTTTCGTCCAATCGTGTTATTATCCACCAATCAGTATGGCGAGATCCAAAATAGTAATGATTGTAGCTGCTATTATTGC
-:GGCTGATGTTGGCATGGAAGTTGGCTTTATATTATGGCTGAGGCCCCTTTACGAGAAGGGTGTTAAATGGCCCGATCTGA
+ GGCTGATGTTGGCATGGAAGTTGGCTTTATATTATGGCTGAGGCCCCTTTACGAGAAGGGTGTTAAATGGCCCGATCTGA
-:TTTTTGGTATTTCTGCATCTGTTTTGTTAGCTGTCGGACTGCTTCCACCTTACTTTGAACTAGCCAAAAGGAAAGGTCGT
+ TTTTTGGTATTTCTGCATCTGTTTTGTTAGCTGTCGGACTGCTTCCACCTTACTTTGAACTAGCCAAAAGGAAAGGTCGT
-:GTTATTGGCATCAACTTTGCCTTCTTATTCATCGATTCATTAGGTGCTTGGCTATCTATCATCAGTGTTATCCTAGGTAA
+ GTTATTGGCATCAACTTTGCCTTCTTATTCATCGATTCATTAGGTGCTTGGCTATCTATCATCAGTGTTATCCTAGGTAA
-:TATGGATATTATGGGTATTATATTATACTCAATAGTTGCTGGAATGGAGTTAGGAATTTTCGCGTCTCATTTCATATGGT
+ TATGGATATTATGGGTATTATATTATACTCAATAGTTGCTGGAATGGAGTTAGGAATTTTCGCGTCTCATTTCATATGGT
-:GGTGTAGGTTTAGATTCCTAGCTAAAGGCAATACTTTTGACGAAGAAAGTGGCCAAGCTCAAAAGGAAGAACCCGATGAA
+ GGTGTAGGTTTAGATTCCTAGCTAAAGGCAATACTTTTGACGAAGAAAGTGGCCAAGCTCAAAAGGAAGAACCCGATGAA
-:AAAATCGAACAAGATATTAGCAAGAGTGACCGAAATGTTACTAACTATAACCTGGATAACTGTTCAATCCCCGACGATGC
+ AAAATCGAACAAGATATTAGCAAGAGTGACCGAAATGTTACTAACTATAACCTGGATAACTGTTCAATCCCCGACGATGC
-:TTCGAGCTTTGCAGACGATTTTAATATATACGATAGTACTGATGGGGGGACGTTATCAAGAGCCCAAACATTGCATGCTG
+ TTCGAGCTTTGCAGACGATTTTAATATATACGATAGTACTGATGGGGGGACGTTATCAAGAGCCCAAACATTGCATGCTG
-:TCCATGGAGTTGTGGTTAGAACAGATCCTGATCGTTATTCGAGGCTAAGTGTGTAA
+ TCCATGGAGTTGTGGTTAGAACAGATCCTGATCGTTATTCGAGGCTAAGTGTGTAA
 '''What is the protein sequence corresponding to your gene?'''
 * Frame 1, located in the image, is the protein sequence that corresponds to the gene.

@@ Line 43: / Line 43: @@
 * If a 3D structure of the protein your gene encodes is available, you can choose to embed a rotating image of the structure on your page using the FirstGlance in Jmol software. This is optional, a different static image would be OK, too.
 [[Image:YDR090CProtein.png|thumb|center|600px|Results containing protein sequence for YDR090C. Translated from ExPASy.]]
-[[File:Shared Phenotypes.png|300px|thumb|center|This diagram displays phenotype observables (purple squares) that are shared between the given gene (yellow circle) and other genes (gray circles) based on the number of phenotype observables shared (adjustable using the slider at the bottom).]]
+[[File:Shared Phenotypes.png|600px|thumb|center|This diagram displays phenotype observables (purple squares) that are shared between the given gene (yellow circle) and other genes (gray circles) based on the number of phenotype observables shared (adjustable using the slider at the bottom).]]
 == Acknowledgements ==

@@ Line 1: / Line 1: @@
 == "Our Favorite Gene": ILT1/YDR090C ==
-Gene ILT1 / YDR090C, part of the Saccharomyces Cerevisiae family, is an integral membrane protein (IMP) located on Chromosome IV on the reverse strand that has an unknown molecular function and biological process. It has a molecular weight of 34626.8 Da and an amino acid length of 310. It's primary transcript is YDR090C_mRNA, although much like it's function, information on this gene is unknown/assumed.
+Gene ILT1 / YDR090C, part of the Saccharomyces Cerevisiae family, is an integral membrane protein (IMP) located on Chromosome IV on the reverse strand that has an unknown molecular function and biological process. It has a molecular weight of 34626.8 Da and an amino acid length of 310. It's primary transcript is YDR090C_mRNA, although much like it's function, information on this gene is unknown and/or assumed.
 == Additional Information ==