https://xmlpipedb2024.lmucs.io/biodb/fall2019/index.php?action=history&feed=atom&title=Jcowan4_Journal_Week_2 2026-07-03T09:31:04Z Revision history for this page on the wiki MediaWiki 1.32.1 https://xmlpipedb2024.lmucs.io/biodb/fall2019/index.php?title=Jcowan4_Journal_Week_2&diff=1935&oldid=prev 2019-09-16T16:11:26Z

<p>‎<span dir="auto"><span class="autocomment">References: </span> invoke template</span></p> <table class="diff diff-contentalign-left" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">Revision as of 16:11, 16 September 2019</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l53" >Line 53:</td> <td colspan="2" class="diff-lineno">Line 53:</td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Aipotu. (2017, May 24). Retrieved on September 11, 2019 from http://aipotu.umb.edu/</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>Aipotu. (2017, May 24). Retrieved on September 11, 2019 from http://aipotu.umb.edu/</div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">[[User: </del>jcowan4<del class="diffchange diffchange-inline">| jcowan4]]</del></div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">{{</ins>jcowan4<ins class="diffchange diffchange-inline">}}</ins></div></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td colspan="2"> </td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">[[Week 2| Week 2 Assignment]]</del></div></td><td colspan="2"> </td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td colspan="2"> </td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">[[Category: Journal Entry]]</del></div></td><td colspan="2"> </td></tr> </table>

Jcowan4 https://xmlpipedb2024.lmucs.io/biodb/fall2019/index.php?title=Jcowan4_Journal_Week_2&diff=1779&oldid=prev 2019-09-12T07:08:42Z

<p>‎<span dir="auto"><span class="autocomment">Your Results: </span> finishing the results</span></p> <table class="diff diff-contentalign-left" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">Revision as of 07:08, 12 September 2019</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l30" >Line 30:</td> <td colspan="2" class="diff-lineno">Line 30:</td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*c) Which DNA sequences are found in each of the four starting organisms?</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*c) Which DNA sequences are found in each of the four starting organisms?</div></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:Green-1:AGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACCGCCGTCATCATCCCCCGCA </ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:Green-2: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACAGCCGTCATCATCCCCCGCA</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:Red: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACAAGACAGCCGTCATCATCCCCCGCA</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:White: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACCAGACAGCCGTCATCATCCCCCGCA</ins></div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*d) Using this knowledge, construct a pure-breeding purple organism.</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*d) Using this knowledge, construct a pure-breeding purple organism.</div></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:The protein sequence we found with help from the biochemistry group is AMINO SEQUENCE: Met Ser Asn Arg His Ile Leu Leu Val Val Tyr Phe Cys Arg Gln </ins></div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?</div></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:DNA sequence of different alleles are mistakes in the trancription process that cause different amino acids to be made. The change of the amino acid changes the the sequence causing a new expression to be formed.</ins></div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>*f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)</div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr> </table>

Jcowan4 https://xmlpipedb2024.lmucs.io/biodb/fall2019/index.php?title=Jcowan4_Journal_Week_2&diff=1776&oldid=prev 2019-09-12T07:01:36Z

<p>‎<span dir="auto"><span class="autocomment">Your Results: </span> Pasting in the result from collaborated work</span></p> <table class="diff diff-contentalign-left" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">Revision as of 07:01, 12 September 2019</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l17" >Line 17:</td> <td colspan="2" class="diff-lineno">Line 17:</td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>#We then altered the amino acid sequence to make a pure purple protein/flower</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>#We then altered the amino acid sequence to make a pure purple protein/flower</div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>==Your Results==  </div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>==Your Results==</div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*a) What are the differences in the DNA sequences of the alleles you defined in Part I.</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:Blue and Yellow- DNA sequence: #79 (A for G), #80 (C for G)</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:Red and White- DNA sequence: #79 (A for G)</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:Red and Blue- DNA sequence: #79 (T for A)</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:Red and Yellow- DNA sequence: #79 (T for G), #80 (C for G)</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:Green and Red- DNA sequence: #79 (A for T), #80 (G for T)</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences.</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">:Yes because white alleles are all the same due to the recessive gene. All white DNA sequences are the same</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*c) Which DNA sequences are found in each of the four starting organisms?</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*d) Using this knowledge, construct a pure-breeding purple organism.</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)</ins></div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==A Scientific Conclusion==</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==A Scientific Conclusion==</div></td></tr> </table>

Jcowan4 https://xmlpipedb2024.lmucs.io/biodb/fall2019/index.php?title=Jcowan4_Journal_Week_2&diff=1774&oldid=prev 2019-09-12T06:54:55Z

<p>‎<span dir="auto"><span class="autocomment">A Scientific Conclusion: </span> editing the conclusion</span></p> <table class="diff diff-contentalign-left" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">Revision as of 06:54, 12 September 2019</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l21" >Line 21:</td> <td colspan="2" class="diff-lineno">Line 21:</td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==A Scientific Conclusion==</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==A Scientific Conclusion==</div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What was your main finding for today&#039;s project? Did you fulfill the purpose? Why or why not?</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What was your main finding for today&#039;s project? Did you fulfill the purpose? Why or why not?</div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">*The main finding was how to figure out how to affect DNA sequence and amino acid sequence in order to create a new breed type of plant. Also, to understand how to locate and figure out what each sequence does and how it represents the object. We fulfilled our purpose because we figured out how to locate and create a new breed of purple flowers.</ins></div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==Acknowledgements==</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==Acknowledgements==</div></td></tr> </table>

Jcowan4 https://xmlpipedb2024.lmucs.io/biodb/fall2019/index.php?title=Jcowan4_Journal_Week_2&diff=1768&oldid=prev 2019-09-12T06:51:36Z

<p>‎<span dir="auto"><span class="autocomment">Your Methods: </span> fixed numbering</span></p> <table class="diff diff-contentalign-left" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">Revision as of 06:51, 12 September 2019</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l11" >Line 11:</td> <td colspan="2" class="diff-lineno">Line 11:</td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What did you actually do? Give a step by step account.</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What did you actually do? Give a step by step account.</div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>#Using the information fromo gentics and part 1 we cross bred plants to find the purple protein</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>#Using the information fromo gentics and part 1 we cross bred plants to find the purple protein</div></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">#</del>#Repeated process to find all combination for the purple protein (one combination only)</div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#Repeated process to find all combination for the purple protein (one combination only)</div></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">##</del>#After finding the purple protein my homework partner and I compared the DNA sequence of different plants</div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#After finding the purple protein my homework partner and I compared the DNA sequence of different plants</div></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">###</del>#After the comparing the DNA sequence we proceeded to compare amino acid chains</div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#After the comparing the DNA sequence we proceeded to compare amino acid chains</div></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">####</del>#We then located the amino acids that create the purple pigmentation</div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#We then located the amino acids that create the purple pigmentation</div></td></tr> <tr><td class='diff-marker'>−</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">#####</del>#We then altered the amino acid sequence to make a pure purple protein/flower</div></td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#We then altered the amino acid sequence to make a pure purple protein/flower</div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==Your Results==  </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==Your Results==  </div></td></tr> </table>

Jcowan4 https://xmlpipedb2024.lmucs.io/biodb/fall2019/index.php?title=Jcowan4_Journal_Week_2&diff=1767&oldid=prev 2019-09-12T06:50:57Z

<p>First edit and answering of week 2 homework</p> <table class="diff diff-contentalign-left" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #222; text-align: center;">Revision as of 06:50, 12 September 2019</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td> <td colspan="2" class="diff-lineno">Line 1:</td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==The Purpose==</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==The Purpose==</div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What was the purpose of your investigations?</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What was the purpose of your investigations?</div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">:The purpose was to:</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">::*Determine differences in DNA sequence of alleles</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">::*Determine how DNA sequence of pigment protein genes determines color of the protein produced</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">::*Figure out how the results of how alleles interact</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">::*Construct a purple proptein</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==Your Methods==  </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==Your Methods==  </div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What did you actually do? Give a step by step account.</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What did you actually do? Give a step by step account.</div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">#Using the information fromo gentics and part 1 we cross bred plants to find the purple protein</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">##Repeated process to find all combination for the purple protein (one combination only)</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">###After finding the purple protein my homework partner and I compared the DNA sequence of different plants</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">####After the comparing the DNA sequence we proceeded to compare amino acid chains</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">#####We then located the amino acids that create the purple pigmentation</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">######We then altered the amino acid sequence to make a pure purple protein/flower</ins></div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==Your Results==  </div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==Your Results==  </div></td></tr> <tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l9" >Line 9:</td> <td colspan="2" class="diff-lineno">Line 21:</td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==A Scientific Conclusion==</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==A Scientific Conclusion==</div></td></tr> <tr><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What was your main finding for today&#039;s project? Did you fulfill the purpose? Why or why not?</div></td><td class='diff-marker'> </td><td style="background-color: #f8f9fa; color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>What was your main finding for today&#039;s project? Did you fulfill the purpose? Why or why not?</div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">==Acknowledgements==</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">*Dr. Dahlquist</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">*Yeabsira Mesfin</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">*</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">&quot;Except for what is noted above, this individual journal entry was completed by me and not copied from another source.&quot; </ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">==References==</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">Aipotu. (2017, May 24). Retrieved on September 11, 2019 from http://aipotu.umb.edu/</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">[[User: jcowan4| jcowan4]]</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">[[Week 2| Week 2 Assignment]]</ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">[[Category: Journal Entry]]</ins></div></td></tr> </table>

Jcowan4 https://xmlpipedb2024.lmucs.io/biodb/fall2019/index.php?title=Jcowan4_Journal_Week_2&diff=1762&oldid=prev 2019-09-12T06:38:20Z

<p>outline for answer the purpose questions</p> <p><b>New page</b></p><div>==The Purpose==<br /> What was the purpose of your investigations?<br /> <br /> ==Your Methods== <br /> What did you actually do? Give a step by step account.<br /> <br /> ==Your Results== <br /> <br /> ==A Scientific Conclusion==<br /> What was your main finding for today&#039;s project? Did you fulfill the purpose? Why or why not?</div>

Jcowan4