Msamdars Week 2 - Revision history

Msamdars: /* Acknowledgement */

2019-09-26T03:04:22Z

‎Acknowledgement

2019-09-12T05:50:07Z

‎Conclusion: finish conclusion.

2019-09-12T05:33:27Z

‎Task E: Add Task E

2019-09-12T04:27:29Z

add reference for amino acid table

2019-09-11T22:39:42Z

‎Task D

2019-09-11T22:39:24Z

‎Task D

2019-09-11T22:38:34Z

‎Task D

2019-09-11T22:38:23Z

‎Acknowledgement

2019-09-11T22:38:15Z

2019-09-11T22:36:58Z

‎References

@@ Line 126: / Line 126: @@
 {{Template:msamdars}}
-==Acknowledgement==
+==Acknowledgements==
 This week my partner was [[User:Jnimmers| John Nimmers-Minor]]. We worked in and out of class together to better understand the questions. I also asked [[User:Marmas| Mike Armas]] for assistance with Task D, as he was working on the Biochemistry portion of this assignment.

← Older revision		Revision as of 05:50, 12 September 2019
Line 121:		Line 121:

	===Conclusion===		===Conclusion===
		+	During the course of this project, I better understood how the variations in genetic information can have an impact on the downstream mRNA and amino acid sequences. Furthermore, by doing this project, I understood how scientists use more complicated tools to analyze organismal DNA and amino acid compositions in organisms that are not the sample organisms provided by the Aipotu. We identified how insertions and mutations can change amino acid sequences and the function of the proteins. I identified how tiny changes in the alleles combined with other tiny changes in alleles can create entirely new phenotypes.

	==Other Links==		==Other Links==

← Older revision		Revision as of 05:33, 12 September 2019
Line 113:		Line 113:

	====Task E====		====Task E====
		+	Because of the central model of molecular biology, a single mutation in the DNA sequence changes the corresponding mRNA, which in turn changes the composition of the amino acid sequence of the proteins. Thus, the variation in the alleles in combination with the mutations creates the variation in the effects that we saw in Part I.

	====Task F====		====Task F====

@@ Line 29: / Line 29: @@
 ====Task F====
-# Looked up single-letter codes for amino acids
+# Looked up single-letter codes for amino acids (John et al., 2017)
 # Utilized Biochemistry window to type in the single letter codes
 #* The entry window automatically translates single letter inputs via the keyboard into the appropriate amino acids.
@@ Line 133: / Line 133: @@
 # LMU BioDB 2019. (2019). Week 2. Retrieved September 11, 2019, from https://xmlpipedb.cs.lmu.edu/biodb/fall2019/index.php/Week_
 # MediaWiki (2019). Category: Help. Retrieved September 11, 2019, from https://www.mediawiki.org/wiki/Category:Help

@@ Line 103: / Line 103: @@
 ====Task D====
 A purple flower is created by adding Phenylalanine codon to the DNA that encodes the Red allele, or a Tyrosine codon to the DNA that encodes the Blue protein. An example with the DNA fragment that encodes the Red allele is shown below, with the position of the codon underlined and in red. The amino acid sequence is shown below as well, with the position of the addition of Phenylalanine underlined and in red. Because the DNA sequence encodes for a protein that is itself purple, it doesn't rely on the co-dominance of blue and red alleles in order to make a purple-colored protein, thus it will be pure-breeding and purple.
 '''DNA Sequence'''
 <code>CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG<u style="color: red">'''TAT'''</u>TTCTGTCGGCAGTAGTAGGGGGCGT</code>
 '''Amino Acid Sequence'''
 <code>N-MetSerAsnArgHisIleLeuLeuVal<u style="color: red">'''Tyr'''</u>PheCysArgGln-C</code>

← Older revision		Revision as of 22:38, 11 September 2019
Line 105:		Line 105:

	<code>CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG<u style="color: red">'''TAT'''</u>TTCTGTCGGCAGTAGTAGGGGGCGT</code>		<code>CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG<u style="color: red">'''TAT'''</u>TTCTGTCGGCAGTAGTAGGGGGCGT</code>
−
−	~~<br>~~

	<code>N-MetSerAsnArgHisIleLeuLeuVal<u style="color: red">'''Tyr'''</u>PheCysArgGln-C</code>		<code>N-MetSerAsnArgHisIleLeuLeuVal<u style="color: red">'''Tyr'''</u>PheCysArgGln-C</code>

@@ Line 68: / Line 68: @@
 |White
 |<code>CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT</code>
-|<pre>N-MetSerAsnArgHisIleLeuLeuValValCysArgGln-C</code>
+|<code>N-MetSerAsnArgHisIleLeuLeuValValCysArgGln-C</code>
 |}

@@ Line 130: / Line 130: @@
 ==References==
-# LMU BioDB 2019. (2019). Week 2. Retrieved September 11, 2019, from https://xmlpipedb.cs.lmu.edu/biodb/fall2019/index.php/Week_2
+# LMU BioDB 2019. (2019). Week 2. Retrieved September 11, 2019, from https://xmlpipedb.cs.lmu.edu/biodb/fall2019/index.php/Week_
 # MediaWiki (2019). Category: Help. Retrieved September 11, 2019, from https://www.mediawiki.org/wiki/Category:Help