ILT1/YDR090C Week 3

"Our Favorite Gene": ILT1/YDR090C

Gene ILT1 / YDR090C, part of the Saccharomyces Cerevisiae family, is an integral membrane protein (IMP) located on Chromosome IV on the reverse strand that has an unknown molecular function and biological process. It has a molecular weight of 34626.8 Da and an amino acid length of 310. It's primary transcript is YDR090C_mRNA, although much like it's function, information on this gene is unknown/assumed.

Additional Information

ILT1/YDR090C

1. What is the standard name, systematic name, and name description for your gene (from SGD)?
   • Standard name: ILT1
   • Systematic name: YDR090C
   • Name description for gene: Ionic Liquid Tolerance
2. What is the gene ID (identifier) for your gene in all four databases (SGD, NCBI Gene, Ensembl, UniProt)? Provide hyperlinks to the specific pages for your gene in each of the above databases.
   • Gene ID:
     • SGD - SGD:S000002497 - For more information, visit Saccharomyces Genome Database
     • NCBI - Gene ID: 851664 - For more information, visit NCBI
     • Ensembl - YDR090C - For more information, visit Ensembl
     • Uniprot - Q03193 (YD090_YEAST) - For more information, visit UniProtKB
3. What is the DNA sequence of your gene?
   • ATGATCTCTGAAAAGGCTGCTACCGCTTTAGCTACTATAGCAACAGTTTGCTGGTGTGTCCAGCTAATTCCGCAAAT

AATATATAATTGGAAAAAAAAGGACTGTACGGGGCTGCCACCACTGATGATGTTCCTCTGGGTTGTTTCCGGAATTCCAT TTGCCATATATTTCTGTGTTAGTAAAGGTAATGTCATTTTACAAGTTCAACCACACCTTTTTATGTTCTTCTGTTCTATA AGTTTCGTCCAATCGTGTTATTATCCACCAATCAGTATGGCGAGATCCAAAATAGTAATGATTGTAGCTGCTATTATTGC GGCTGATGTTGGCATGGAAGTTGGCTTTATATTATGGCTGAGGCCCCTTTACGAGAAGGGTGTTAAATGGCCCGATCTGA TTTTTGGTATTTCTGCATCTGTTTTGTTAGCTGTCGGACTGCTTCCACCTTACTTTGAACTAGCCAAAAGGAAAGGTCGT GTTATTGGCATCAACTTTGCCTTCTTATTCATCGATTCATTAGGTGCTTGGCTATCTATCATCAGTGTTATCCTAGGTAA TATGGATATTATGGGTATTATATTATACTCAATAGTTGCTGGAATGGAGTTAGGAATTTTCGCGTCTCATTTCATATGGT GGTGTAGGTTTAGATTCCTAGCTAAAGGCAATACTTTTGACGAAGAAAGTGGCCAAGCTCAAAAGGAAGAACCCGATGAA AAAATCGAACAAGATATTAGCAAGAGTGACCGAAATGTTACTAACTATAACCTGGATAACTGTTCAATCCCCGACGATGC TTCGAGCTTTGCAGACGATTTTAATATATACGATAGTACTGATGGGGGGACGTTATCAAGAGCCCAAACATTGCATGCTG TCCATGGAGTTGTGGTTAGAACAGATCCTGATCGTTATTCGAGGCTAAGTGTGTAA

1. What is the protein sequence corresponding to your gene?
   • Go to the ExPASy tool and translate the DNA sequence of your gene. Which reading frame encodes the protein sequence? Take a screenshot of your results, display it on your wiki page, and state which frame it is.
2. What is the function of your gene?
   • The function of this gene is unknown. Information on this gene is putative.
3. What was different about the information provided about your gene in each of the parent databases?
   • Were there differences in content, the information or data itself?
   • Were there differences in presentation of the information?
4. Why did you choose your particular gene? i.e., why is it interesting to you and your partner?
   • This particular gene was chosen because much of its information has yet to be discovered. It is a protein with unknown function and very few research has been conducted and found on this gene. This sparked interest to us because it highlighted the very point of science and why we are biology majors: to discover (using research and evidence) to further identify and/or understand a distinct mechanism, organism, and/or gene.
5. Include an image related to your gene (be careful that you do not violate any copyright restrictions!)
   • Please make the image something scientific (not like the random images seen on the SGD blog posts).
   • If a 3D structure of the protein your gene encodes is available, you can choose to embed a rotating image of the structure on your page using the FirstGlance in Jmol software. This is optional, a different static image would be OK, too.
6. Include Acknowledgments and References sections on your wiki page. Both partners should sign the Academic Honesty statement with their wiki signatures.
   • You need to cite the specific database page from which you derived your information for each of the questions.
   • When answering the free-form questions, be sure to paraphrase.

Acknowledgements

• This section is in acknowledgement to partners, Kaitlyn Nguyen User:Knguye66 and Iliana Crespin User:Icrespin.

Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

References

• ILT1. (n.d.). Retrieved from https://www.yeastgenome.org/locus/S000002497
• YDR090C hypothetical protein [Saccharomyces cerevisiae S288C] - Gene - NCBI. (n.d.). Retrieved from https://www.ncbi.nlm.nih.gov/gene/851664
• Gene: YDR090C. (n.d.). Retrieved from https://uswest.ensembl.org/Saccharomyces_cerevisiae/Gene/Summary?db=core;g=YDR090C;r=IV:625066-625998;t=YDR090C_mRNA
• UniProt ConsortiumEuropean Bioinformatics InstituteProtein Information ResourceSIB Swiss Institute of Bioinformatics. (2019, May 8). Uncharacterized membrane protein YDR090C. Retrieved from https://www.uniprot.org/uniprot/Q03193

Wikipedia Techniques:

• [Cedrick May]. (2014, August 26). Adding Hyperlinks to a Wiki Page [Video file]. Retrieved from https://www.youtube.com/watch?v=J50espeRSs8&t=137s
• Hyperlink. (2019, September 8). Retrieved from https://en.wikipedia.org/wiki/Hyperlink