Difference between revisions of "Kevin Wyllie Week 3"
From LMU BioDB 2015
(Added a screenshot.) |
(Syntax fix.) |
||
| Line 5: | Line 5: | ||
[[Image:Kwscreenshot1.jpg|right|thumb]] | [[Image:Kwscreenshot1.jpg|right|thumb]] | ||
| − | + | * Shown in green: the following command is used to open the file (using prokaryote.txt as an example). | |
cat prokaryote.txt | cat prokaryote.txt | ||
| − | + | * Shown in red: the following command is used to sequence the complementary strand (in the 5' -> 3' direction - thus the "rev" command). | |
cat prokaryote.txt | sed "y/atgc/tacg/" | rev | cat prokaryote.txt | sed "y/atgc/tacg/" | rev | ||
| − | + | * Finally, the sequence of the complementary strand is (copy/pasted from the command line window): | |
5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3' | 5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3' | ||
| Line 23: | Line 23: | ||
[[Image:Kwscreenshot2.jpg|right|thumb]] | [[Image:Kwscreenshot2.jpg|right|thumb]] | ||
| − | + | * Shown in green: to separate the strand into codons (resulting in the +1 frame): | |
cat prokaryote.txt | sed "s/.../& /g" | cat prokaryote.txt | sed "s/.../& /g" | ||
| − | + | * Shown in red: to convert to the mRNA sequence (treating the DNA stand as the mRNA-like strand): | |
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | ||
| − | + | * Shown in blue: to translate this mRNA sequence: | |
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed | cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed | ||
Revision as of 00:20, 20 September 2015
Journal Week 3
Complement of a Strand
- Shown in green: the following command is used to open the file (using prokaryote.txt as an example).
cat prokaryote.txt
- Shown in red: the following command is used to sequence the complementary strand (in the 5' -> 3' direction - thus the "rev" command).
cat prokaryote.txt | sed "y/atgc/tacg/" | rev
- Finally, the sequence of the complementary strand is (copy/pasted from the command line window):
5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3'
Reading Frames
The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.
- Shown in green: to separate the strand into codons (resulting in the +1 frame):
cat prokaryote.txt | sed "s/.../& /g"
- Shown in red: to convert to the mRNA sequence (treating the DNA stand as the mRNA-like strand):
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/"
- Shown in blue: to translate this mRNA sequence:
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
