Difference between revisions of "Kevin Wyllie Week 3"
From LMU BioDB 2015
(That didn't work. For the time being, the headings may just look a little confusing.) |
(More heading edits.) |
||
| Line 1: | Line 1: | ||
| − | + | ===Complement of a Strand=== | |
| − | + | ||
| − | + | ||
[[Image:Kwscreenshot1.jpg|right|thumb]] | [[Image:Kwscreenshot1.jpg|right|thumb]] | ||
| Line 17: | Line 15: | ||
5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3' | 5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3' | ||
| − | + | ===Reading Frames=== | |
''The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.'' | ''The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.'' | ||
| − | + | ====+1, +2, and +3 Frames==== | |
[[Image:Kwscreenshot2.jpg|right|thumb]] | [[Image:Kwscreenshot2.jpg|right|thumb]] | ||
Revision as of 00:59, 20 September 2015
Complement of a Strand
- Shown in green: the following command is used to open the file (using prokaryote.txt as an example).
cat prokaryote.txt
- Shown in red: the following command is used to sequence the complementary strand (in the 5' -> 3' direction - thus the "rev" command).
cat prokaryote.txt | sed "y/atgc/tacg/" | rev
- Finally, the sequence of the complementary strand is (copy/pasted from the command line window):
5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3'
Reading Frames
The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.
+1, +2, and +3 Frames
- Shown in green: to separate the strand into codons (resulting in the +1 frame):
cat prokaryote.txt | sed "s/.../& /g"
- Shown in red: to convert to the mRNA sequence (treating the DNA stand as the mRNA-like strand):
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/"
- Shown in blue: to translate this mRNA sequence:
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
- For the +2 frame, the final pipe can be slightly altered:
cat prokaryote.txt | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
- And similarly, for the +3 frame:
cat prokaryote.txt | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
