Difference between revisions of "Malverso Week 4"

From LMU BioDB 2015
Jump to: navigation, search
(added journal list template.)
 
(answered #1 -35 box)
Line 1: Line 1:
 +
==Transcription and Translation "Taken to the Next Level"==
 +
 +
I completed this assignment using Putty.exe by accessing infA-E.coli-K12.txt in ~dondi/xmlpipedb/data.
 +
 +
===#1===
 +
 +
====-35 box of the promoter====
 +
 +
*Looking over my notes of when I first attempted this assignment in class, I used the sed command to find all the places where the pattern tt[gt]ac[at] occurred and attached a <minus35box> tag to the beginning of that sequence and a </minus35box> to the end. This resulted with two possible locations for the -35 box being tagged.
 +
*Since it was given that there were 17 base pairs between the -35 box and the -10 box, I used that clue to identify which -35 box tags were correct, as well as a bit pf guess and check. I just assumed the first -35 box tag was correct and modified my sed command to only tag the first instance of the -35 box pattern by replacing the g at the end with a 1. I also added an \n to the end of the box tags so that a new line would start after the last -35 box tag. Referring back to my in class notes, I added a sed command on to search for the base pair possibilities for the -10 box as well as a command that would show me the point after 17 characters from the end of my -35 box:
 +
cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1" | sed -r "2s/^(.){17}/&<here?>/g" | sed "s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"
 +
 +
This confirmed that the first instance of the -35 box pattern match was the correct one. To calculate just where the -35 box is, I can now use the code:
 +
cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>/1"
 +
 +
Which produces:(The below sequence includes line breaks for readability)
 +
 +
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttac
 +
gctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcccgctcccttatac
 +
gttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgc
 +
aaatc<minus35box>tttact</minus35box>tatttacagaacttcggcattatcttgccggttcaaatt
 +
acggtagtgataccccagaggattagatggccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgt
 +
tgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgca
 +
aaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgca
 +
ttgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaacc
 +
ggcctttttattttat
 +
 +
 
{{Template:Malverso}}
 
{{Template:Malverso}}

Revision as of 18:31, 28 September 2015

Transcription and Translation "Taken to the Next Level"

I completed this assignment using Putty.exe by accessing infA-E.coli-K12.txt in ~dondi/xmlpipedb/data.

#1

-35 box of the promoter

  • Looking over my notes of when I first attempted this assignment in class, I used the sed command to find all the places where the pattern tt[gt]ac[at] occurred and attached a <minus35box> tag to the beginning of that sequence and a </minus35box> to the end. This resulted with two possible locations for the -35 box being tagged.
  • Since it was given that there were 17 base pairs between the -35 box and the -10 box, I used that clue to identify which -35 box tags were correct, as well as a bit pf guess and check. I just assumed the first -35 box tag was correct and modified my sed command to only tag the first instance of the -35 box pattern by replacing the g at the end with a 1. I also added an \n to the end of the box tags so that a new line would start after the last -35 box tag. Referring back to my in class notes, I added a sed command on to search for the base pair possibilities for the -10 box as well as a command that would show me the point after 17 characters from the end of my -35 box:
cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1" | sed -r "2s/^(.){17}/&<here?>/g" | sed "s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"

This confirmed that the first instance of the -35 box pattern match was the correct one. To calculate just where the -35 box is, I can now use the code: 

cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>/1"

Which produces:(The below sequence includes line breaks for readability) 

ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttac
gctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcccgctcccttatac
gttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgc
aaatc<minus35box>tttact</minus35box>tatttacagaacttcggcattatcttgccggttcaaatt
acggtagtgataccccagaggattagatggccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgt
tgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgca
aaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgca
ttgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaacc
ggcctttttattttat


Team Page

Heavy Metal HaterZ

Assignments

Individual Journal Entries

Shared Journal Entries

Retrieved from "https://xmlpipedb.lmucs.io/biodb/fall2015/index.php?title=Malverso_Week_4&oldid=1826"