Difference between revisions of "Kevin Wyllie Week 3"

Revision as of 18:22, 21 September 2015

Complement of a Strand

• Shown in green: the following command is used to open the file (using prokaryote.txt as an example).

cat prokaryote.txt

• Shown in red: the following command is used to sequence the complementary strand (in the 5' -> 3' direction - thus the "rev" command).

cat prokaryote.txt | sed "y/atgc/tacg/" | rev

• These commands yield the nucleotide sequence:
  • 5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3'

Reading Frames

The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.

+1, +2, and +3 Frames

• Shown in green: to separate the strand into codons (resulting in the +1 frame):

cat prokaryote.txt | sed "s/.../& /g"

• Shown in red: to convert to the mRNA sequence (treating the DNA strand as the mRNA-like strand):

cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/"

• Shown in blue: to translate this mRNA sequence (yielding the +1 frame):

cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• For the +2 frame, the final pipe can be slightly altered:

cat prokaryote.txt | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• And similarly, for the +3 frame:

cat prokaryote.txt | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• These pipes yield the following amino acid sequences (shown on right):
  • +1 Nter- S T I F Q -Cter (shown in red)
  • +2 Nter- L L Y F N R Y D G Q R R Q Y -Cter (shown in green)
  • +3 Nter- Y Y I S I G T M A K E D N I E L E T L P N T M F R V -Cter (shown in blue)

-1, -2, and -3 Frames

• For the -1 frame, open the file as usual, and then use the pipe from "Complement of a Strand" so that the commands after it will be applied to the complementary strand (instead of the original strand). Then, add the same pipe used for the +1 strand:

cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• As before, the -2 and -3 frames can be found by making a single adjustment to the pipe for the -1 frame. For the -2 frame:

cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• And for the -3 frame:

cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• These pipes yield the following amino acid sequences (shown on right):
  • -1 Nter- V K M P P A E L A A G L Y A E H G I R Q R F K F N I V F F G H R T Y -Cter (shown in red)
  • -2 Nter- L K C R Q R N W R L G Y T R N M V L G N V S S S I L S S L A I V P I E I -Cter (shown in green)
  • -3 No polypeptide - first codon is STOP. (shown in blue)

XMLPipeDB Match Practice

• To count the occurrence of GO:0005, GO:0006, and GO:0007 (shown on right):

cat 493.P_falciparum.xml | java -jar xmlpipedb-match-1.1.1.jar "GO:000[567]"

• There are three unique matches (the maximum possible for this command).
  • GO:0005 occurred 1,371 times.
  • GO:0006 occurred 1,100 times.
  • GO:0007 occurred 113 times.

• To find GO:0007 "in situ" (shown on right):

grep "GO:0007" 493.P_falciparum.xml

• Looking at the text found on the same lines as this pattern, it appears to be the first few characters of a gene ID. Based on prior knowledge, it also may have something to do with gene ontology, as I have seen "GO" as an acronym for that term before.

• To count the occurrence of \"Yu.*\" (shown on right):

cat "493.P_falciparum.xml" | java -jar xmlpipedb-match-1.1.1.jar "\"Yu.*\""

• There are three unique matches.
  • "yu b." occurred one time.
  • "yu k." occurred 228 times.
  • "yu m." occurred one time.
• A grep command for this pattern brings up lines such as:

<person name="Yu K."/>

So these may be names of biologists, perhaps those who were responsible for the discovery of a given gene.

• To count occurrence of of "ATG."
  • The match function finds 830,101 matches in hs_ref_GRCh37_chr19.fa (shown on right, in green).
  • Connecting grep to wc finds 502,410 lines, 502,410 words and 35,671,048 characters (shown on right, in red).
  • This discrepancy in matches is due to the differences in the functions. The Match function looks for the pattern outright, while grep-wc looks at the entirety of any line in which the pattern is found. The numbers that grep-wc returns apply to the lines that "ATG" is found in, not just the "ATG" pattern itself.