Difference between revisions of "Malverso Week 4"

From LMU BioDB 2015
Jump to: navigation, search
(answered #1 -35 box)
(answered #1 -10 box)
Line 2: Line 2:
  
 
I completed this assignment using Putty.exe by accessing infA-E.coli-K12.txt in ~dondi/xmlpipedb/data.
 
I completed this assignment using Putty.exe by accessing infA-E.coli-K12.txt in ~dondi/xmlpipedb/data.
 +
I added line breaks in the sequences and commands when necessary to enhance readability.
  
 
===#1===
 
===#1===
Line 9: Line 10:
 
*Looking over my notes of when I first attempted this assignment in class, I used the sed command to find all the places where the pattern tt[gt]ac[at] occurred and attached a <minus35box> tag to the beginning of that sequence and a </minus35box> to the end. This resulted with two possible locations for the -35 box being tagged.  
 
*Looking over my notes of when I first attempted this assignment in class, I used the sed command to find all the places where the pattern tt[gt]ac[at] occurred and attached a <minus35box> tag to the beginning of that sequence and a </minus35box> to the end. This resulted with two possible locations for the -35 box being tagged.  
 
*Since it was given that there were 17 base pairs between the -35 box and the -10 box, I used that clue to identify which -35 box tags were correct, as well as a bit pf guess and check. I just assumed the first -35 box tag was correct and modified my sed command to only tag the first instance of the -35 box pattern by replacing the g at the end with a 1. I also added an \n to the end of the box tags so that a new line would start after the last -35 box tag. Referring back to my in class notes, I added a sed command on to search for the base pair possibilities for the -10 box as well as a command that would show me the point after 17 characters from the end of my -35 box:
 
*Since it was given that there were 17 base pairs between the -35 box and the -10 box, I used that clue to identify which -35 box tags were correct, as well as a bit pf guess and check. I just assumed the first -35 box tag was correct and modified my sed command to only tag the first instance of the -35 box pattern by replacing the g at the end with a 1. I also added an \n to the end of the box tags so that a new line would start after the last -35 box tag. Referring back to my in class notes, I added a sed command on to search for the base pair possibilities for the -10 box as well as a command that would show me the point after 17 characters from the end of my -35 box:
−
  cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1" | sed -r "2s/^(.){17}/&<here?>/g" | sed "s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"
+
  cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1"  
 +
| sed -r "2s/^(.){17}/&<here?>/g" | sed "s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"
  
 
This confirmed that the first instance of the -35 box pattern match was the correct one. To calculate just where the -35 box is, I can now use the code:
 
This confirmed that the first instance of the -35 box pattern match was the correct one. To calculate just where the -35 box is, I can now use the code:
 
  cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>/1"
 
  cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>/1"
  
−
Which produces:(The below sequence includes line breaks for readability)
+
Which produces:
 
   
 
   
 
  ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttac
 
  ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttac
Line 25: Line 27:
 
  ttgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaacc
 
  ttgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaacc
 
  ggcctttttattttat
 
  ggcctttttattttat
 +
 +
====-10 box of the promoter====
 +
 +
* By figuring out which -35 box tags were correct I also figured out which -10 box tags were correct. I added more line breaks to make this clear, and used the code below to produce the code with the correct -10 box tags and correct -35 box tags:
 +
 +
  cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1"
 +
| sed -r "2s/^(.){17}/&\n/g" | sed "3s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"
 +
 +
Which returned:
 +
 +
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacg
 +
ctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacg
 +
ttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaa
 +
atc<minus35box>tttact</minus35box>
 +
tatttacagaacttcgg
 +
<minus10box>cattat</minus10box>cttgccggttcaaattacggtagtgataccccagaggattagatg
 +
gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttag
 +
aaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaa
 +
agtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgc
 +
ctgatgggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat
 +
  
 
   
 
   
 
{{Template:Malverso}}
 
{{Template:Malverso}}

Revision as of 18:45, 28 September 2015

Transcription and Translation "Taken to the Next Level"

I completed this assignment using Putty.exe by accessing infA-E.coli-K12.txt in ~dondi/xmlpipedb/data. I added line breaks in the sequences and commands when necessary to enhance readability.

#1

-35 box of the promoter

  • Looking over my notes of when I first attempted this assignment in class, I used the sed command to find all the places where the pattern tt[gt]ac[at] occurred and attached a <minus35box> tag to the beginning of that sequence and a </minus35box> to the end. This resulted with two possible locations for the -35 box being tagged.
  • Since it was given that there were 17 base pairs between the -35 box and the -10 box, I used that clue to identify which -35 box tags were correct, as well as a bit pf guess and check. I just assumed the first -35 box tag was correct and modified my sed command to only tag the first instance of the -35 box pattern by replacing the g at the end with a 1. I also added an \n to the end of the box tags so that a new line would start after the last -35 box tag. Referring back to my in class notes, I added a sed command on to search for the base pair possibilities for the -10 box as well as a command that would show me the point after 17 characters from the end of my -35 box:
cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1" 
| sed -r "2s/^(.){17}/&<here?>/g" | sed "s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"

This confirmed that the first instance of the -35 box pattern match was the correct one. To calculate just where the -35 box is, I can now use the code: 

cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>/1"

Which produces: 

ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttac
gctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcccgctcccttatac
gttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgc
aaatc<minus35box>tttact</minus35box>tatttacagaacttcggcattatcttgccggttcaaatt
acggtagtgataccccagaggattagatggccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgt
tgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgca
aaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgca
ttgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaacc
ggcctttttattttat

-10 box of the promoter

  • By figuring out which -35 box tags were correct I also figured out which -10 box tags were correct. I added more line breaks to make this clear, and used the code below to produce the code with the correct -10 box tags and correct -35 box tags:
 cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1" 
| sed -r "2s/^(.){17}/&\n/g" | sed "3s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"

Which returned: 

ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacg
ctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacg
ttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaa
atc<minus35box>tttact</minus35box>
tatttacagaacttcgg
<minus10box>cattat</minus10box>cttgccggttcaaattacggtagtgataccccagaggattagatg
gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttag
aaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaa
agtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgc
ctgatgggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat



Team Page

Heavy Metal HaterZ

Assignments

Individual Journal Entries

Shared Journal Entries

Retrieved from "https://xmlpipedb.lmucs.io/biodb/fall2015/index.php?title=Malverso_Week_4&oldid=1831"