Difference between revisions of "Nanguiano Week 2"

From LMU BioDB 2015
Jump to: navigation, search
(Adding first 2 reading frames. Also just creating page so I don't lose everything if I press back.)
 
(finished all top reading frames)
Line 10: Line 10:
 
** Use the single-letter abbreviations for the amino acids because that is what is commonly used by computer programs.
 
** Use the single-letter abbreviations for the amino acids because that is what is commonly used by computer programs.
  
 +
* Note: For the full list of codons, see this [https://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table RNA Codon Table]. The stop codon is indicated by "-".
 
* Top, 1
 
* Top, 1
  RMLIPCSAYNPAASSAGGIL
+
  RNA: cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua
 +
Protein: RMLIPCSAYNPAASSAGGIL
 
* Top, 2
 
* Top, 2
  gua ugc uaa uac cau guu ccg cgu aua acc cag ccg cca guu ccg cug gcg gca uuu
+
  RNA: guaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuu
  VC-YHVPRITQPPVPLAAF
+
Protein: VC-YHVPRITQPPVPLAAF
 
* Top, 3
 
* Top, 3
 +
RNA: uaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuu
 +
Protein: YANTMFRV-PSRQFRWRHF
 
* Bottom, 1
 
* Bottom, 1
 
* Bottom, 2
 
* Bottom, 2

Revision as of 01:14, 11 September 2015

Individual Journal Assignment

The Genetic Code

  • Write out the complementary strand of DNA below the strand shown and be sure to label the 5’ and 3’ ends of the complementary strand.
5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
3’-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5’
  • There are six possible reading frames in double-stranded DNA. Using the genetic code, translate all possible reading frames of this DNA sequence, keeping in mind the following rules.
    • In RNA, the T becomes a U, so everywhere you see a T in the sequence, read it as a U.
    • The genetic code is read in the 5’ to 3’ direction.
    • Use the single-letter abbreviations for the amino acids because that is what is commonly used by computer programs.
  • Note: For the full list of codons, see this RNA Codon Table. The stop codon is indicated by "-".
  • Top, 1
RNA: cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua
Protein: RMLIPCSAYNPAASSAGGIL
  • Top, 2
RNA: guaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuu
Protein: VC-YHVPRITQPPVPLAAF
  • Top, 3
RNA: uaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuu
Protein: YANTMFRV-PSRQFRWRHF
  • Bottom, 1
  • Bottom, 2
  • Bottom, 3


  • Which of the reading frames (if any) of the reading frames you translated is an open reading frame, i.e., does not contain a stop codon?
    • By convention, the top strand frames are called +1, +2, +3, reading 5' to 3' and the bottom strand frames are called -1, -2, -3, reading 5' to 3'.

Links

Nicole Anguiano
BIOL 367, Fall 2015

Assignment Links
Individual Journals
Shared Journals