Difference between revisions of "Kevin Wyllie Week 3"
From LMU BioDB 2015
(Just saving my progress in case of timeout.) |
(Added a screenshot.) |
||
| Line 19: | Line 19: | ||
====Reading Frames==== | ====Reading Frames==== | ||
| − | + | ''The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.'' | |
| + | |||
| + | [[Image:Kwscreenshot2.jpg|right|thumb]] | ||
# Shown in green: to separate the strand into codons (resulting in the +1 frame): | # Shown in green: to separate the strand into codons (resulting in the +1 frame): | ||
Revision as of 00:19, 20 September 2015
Journal Week 3
Complement of a Strand
- Shown in green: the following command is used to open the file (using prokaryote.txt as an example).
cat prokaryote.txt
- Shown in red: the following command is used to sequence the complementary strand (in the 5' -> 3' direction - thus the "rev" command).
cat prokaryote.txt | sed "y/atgc/tacg/" | rev
- Finally, the sequence of the complementary strand is (copy/pasted from the command line window):
5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3'
Reading Frames
The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.
- Shown in green: to separate the strand into codons (resulting in the +1 frame):
cat prokaryote.txt | sed "s/.../& /g"
- Shown in red: to convert to the mRNA sequence (treating the DNA stand as the mRNA-like strand):
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/"
- Shown in blue: to translate this mRNA sequence:
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
