Difference between revisions of "Kevin Wyllie Week 3"

Revision as of 00:57, 20 September 2015

Journal Week 3

====Complement of a Strand==== ----

• Shown in green: the following command is used to open the file (using prokaryote.txt as an example).

cat prokaryote.txt

• Shown in red: the following command is used to sequence the complementary strand (in the 5' -> 3' direction - thus the "rev" command).

cat prokaryote.txt | sed "y/atgc/tacg/" | rev

• Finally, the sequence of the complementary strand is (copy/pasted from the command line window):

5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3'

====Reading Frames==== ----

The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.

+1, +2, and +3 Frames

• Shown in green: to separate the strand into codons (resulting in the +1 frame):

cat prokaryote.txt | sed "s/.../& /g"

• Shown in red: to convert to the mRNA sequence (treating the DNA stand as the mRNA-like strand):

cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/"

• Shown in blue: to translate this mRNA sequence:

cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• For the +2 frame, the final pipe can be slightly altered:

cat prokaryote.txt | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed

• And similarly, for the +3 frame:

cat prokaryote.txt | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed