Difference between revisions of "Kevin Wyllie Week 3"
From LMU BioDB 2015
(Attempted formatting fix.) |
(Changed position of my screenshot.) |
||
| Line 43: | Line 43: | ||
cat prokaryote.txt | '''sed "s/^..//g"''' | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed | cat prokaryote.txt | '''sed "s/^..//g"''' | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed | ||
| − | * These pipes yield the following amino acid sequences (shown on right): | + | [[Image:Kwscreenshot3.jpg|right|thumb]] |
| + | * These pipes yield the following amino acid sequences (shown on right): | ||
** '''+1''' Nter- S T I F Q -Cter (shown in green) | ** '''+1''' Nter- S T I F Q -Cter (shown in green) | ||
** '''+2''' Nter- L L Y F N R Y D G Q R R Q Y -Cter (shown in red) | ** '''+2''' Nter- L L Y F N R Y D G Q R R Q Y -Cter (shown in red) | ||
** '''+3''' Nter- Y Y I S I G T M A K E D N I E L E T L P N T M F R V -Cter (shown in blue) | ** '''+3''' Nter- Y Y I S I G T M A K E D N I E L E T L P N T M F R V -Cter (shown in blue) | ||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
====-1, -2, and -3 Frames==== | ====-1, -2, and -3 Frames==== | ||
Revision as of 01:44, 20 September 2015
Contents
Complement of a Strand
- Shown in green: the following command is used to open the file (using prokaryote.txt as an example).
cat prokaryote.txt
- Shown in red: the following command is used to sequence the complementary strand (in the 5' -> 3' direction - thus the "rev" command).
cat prokaryote.txt | sed "y/atgc/tacg/" | rev
- These commands yield the nucleotide sequence:
- 5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3'
Reading Frames
The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.
+1, +2, and +3 Frames
- Shown in green: to separate the strand into codons (resulting in the +1 frame):
cat prokaryote.txt | sed "s/.../& /g"
- Shown in red: to convert to the mRNA sequence (treating the DNA stand as the mRNA-like strand):
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/"
- Shown in blue: to translate this mRNA sequence (yielding the +1 frame):
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
- For the +2 frame, the final pipe can be slightly altered:
cat prokaryote.txt | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
- And similarly, for the +3 frame:
cat prokaryote.txt | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
- These pipes yield the following amino acid sequences (shown on right):
- +1 Nter- S T I F Q -Cter (shown in green)
- +2 Nter- L L Y F N R Y D G Q R R Q Y -Cter (shown in red)
- +3 Nter- Y Y I S I G T M A K E D N I E L E T L P N T M F R V -Cter (shown in blue)
-1, -2, and -3 Frames
- For the -1 frame, open the file as usual, and then use the pipe from "Complement of a Strand" so that the commands after it will be applied to the complementary strand (instead of the original strand). Then, add the same pipe used for the +1 strand:
cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
- As before, the -2 and -3 frames can be found by making a single adjustment to the pipe for the -1 frame. For the -2 frame:
cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
- And for the -3 frame:
cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
