Difference between revisions of "Nanguiano Week 2"
From LMU BioDB 2015
(Adding first 2 reading frames. Also just creating page so I don't lose everything if I press back.) |
(finished all top reading frames) |
||
| Line 10: | Line 10: | ||
** Use the single-letter abbreviations for the amino acids because that is what is commonly used by computer programs. | ** Use the single-letter abbreviations for the amino acids because that is what is commonly used by computer programs. | ||
| + | * Note: For the full list of codons, see this [https://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table RNA Codon Table]. The stop codon is indicated by "-". | ||
* Top, 1 | * Top, 1 | ||
| − | RMLIPCSAYNPAASSAGGIL | + | RNA: cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua |
| + | Protein: RMLIPCSAYNPAASSAGGIL | ||
* Top, 2 | * Top, 2 | ||
| − | + | RNA: guaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuu | |
| − | + | Protein: VC-YHVPRITQPPVPLAAF | |
* Top, 3 | * Top, 3 | ||
| + | RNA: uaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuu | ||
| + | Protein: YANTMFRV-PSRQFRWRHF | ||
* Bottom, 1 | * Bottom, 1 | ||
* Bottom, 2 | * Bottom, 2 | ||
Revision as of 01:14, 11 September 2015
Contents
Individual Journal Assignment
The Genetic Code
- Write out the complementary strand of DNA below the strand shown and be sure to label the 5’ and 3’ ends of the complementary strand.
5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’ 3’-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5’
- There are six possible reading frames in double-stranded DNA. Using the genetic code, translate all possible reading frames of this DNA sequence, keeping in mind the following rules.
- In RNA, the T becomes a U, so everywhere you see a T in the sequence, read it as a U.
- The genetic code is read in the 5’ to 3’ direction.
- Use the single-letter abbreviations for the amino acids because that is what is commonly used by computer programs.
- Note: For the full list of codons, see this RNA Codon Table. The stop codon is indicated by "-".
- Top, 1
RNA: cguaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua Protein: RMLIPCSAYNPAASSAGGIL
- Top, 2
RNA: guaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuu Protein: VC-YHVPRITQPPVPLAAF
- Top, 3
RNA: uaugcuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuu Protein: YANTMFRV-PSRQFRWRHF
- Bottom, 1
- Bottom, 2
- Bottom, 3
- Which of the reading frames (if any) of the reading frames you translated is an open reading frame, i.e., does not contain a stop codon?
- By convention, the top strand frames are called +1, +2, +3, reading 5' to 3' and the bottom strand frames are called -1, -2, -3, reading 5' to 3'.
Links
Nicole Anguiano
BIOL 367, Fall 2015
Assignment Links
- Week 1 Assignment
- Week 2 Assignment
- Week 3 Assignment
- Week 4 Assignment
- Week 5 Assignment
- Week 6 Assignment
- Week 7 Assignment
- Week 8 Assignment
- Week 9 Assignment
- Week 10 Assignment
- Week 11 Assignment
- Week 12 Assignment
- Week 14 Assignment
- Week 15 Assignment
Individual Journals
- Individual Journal Week 2
- Individual Journal Week 3
- Individual Journal Week 4
- Individual Journal Week 5
- Individual Journal Week 6
- Individual Journal Week 7
- Individual Journal Week 8
- Individual Journal Week 9
- Individual Journal Week 10
- Individual Journal Week 11
- Individual Assessment
- Deliverables